Incidental Mutation 'R0387:Akap9'
ID31333
Institutional Source Beutler Lab
Gene Symbol Akap9
Ensembl Gene ENSMUSG00000040407
Gene NameA kinase (PRKA) anchor protein (yotiao) 9
SynonymsAKAP450, G1-448-15, 5730481H23Rik, mei2-5, repro12
MMRRC Submission 038593-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.332) question?
Stock #R0387 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location3928054-4081310 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 3951678 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044492] [ENSMUST00000143365]
Predicted Effect probably benign
Transcript: ENSMUST00000044492
SMART Domains Protein: ENSMUSP00000046129
Gene: ENSMUSG00000040407

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
low complexity region 98 115 N/A INTRINSIC
Blast:HPT 126 197 6e-21 BLAST
low complexity region 237 249 N/A INTRINSIC
low complexity region 297 315 N/A INTRINSIC
coiled coil region 404 593 N/A INTRINSIC
coiled coil region 622 756 N/A INTRINSIC
coiled coil region 777 843 N/A INTRINSIC
coiled coil region 888 958 N/A INTRINSIC
low complexity region 982 997 N/A INTRINSIC
coiled coil region 1037 1065 N/A INTRINSIC
low complexity region 1233 1246 N/A INTRINSIC
internal_repeat_2 1247 1312 7.75e-5 PROSPERO
internal_repeat_1 1377 1485 2.63e-5 PROSPERO
coiled coil region 1522 1589 N/A INTRINSIC
coiled coil region 1789 2107 N/A INTRINSIC
coiled coil region 2132 2318 N/A INTRINSIC
internal_repeat_1 2322 2445 2.63e-5 PROSPERO
coiled coil region 2455 2494 N/A INTRINSIC
low complexity region 2587 2598 N/A INTRINSIC
low complexity region 2627 2640 N/A INTRINSIC
internal_repeat_2 2934 2997 7.75e-5 PROSPERO
low complexity region 3000 3016 N/A INTRINSIC
coiled coil region 3109 3307 N/A INTRINSIC
coiled coil region 3455 3493 N/A INTRINSIC
coiled coil region 3521 3556 N/A INTRINSIC
Pfam:PACT_coil_coil 3576 3657 1.2e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132058
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141817
Predicted Effect probably benign
Transcript: ENSMUST00000143365
SMART Domains Protein: ENSMUSP00000117209
Gene: ENSMUSG00000040407

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
low complexity region 122 133 N/A INTRINSIC
Blast:HPT 144 215 9e-22 BLAST
low complexity region 255 267 N/A INTRINSIC
low complexity region 315 333 N/A INTRINSIC
coiled coil region 422 571 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177448
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198973
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.7%
  • 10x: 94.2%
  • 20x: 85.0%
Validation Efficiency 99% (77/78)
MGI Phenotype PHENOTYPE: Mice homozygous for a chemically induced allele exhibit male infertily with abnormal spermatogenesis and Sertoli maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T G 7: 120,332,852 probably null Het
Abcc9 T A 6: 142,639,504 K825* probably null Het
Afp T C 5: 90,497,291 C189R probably damaging Het
Alpk3 A T 7: 81,104,227 T1652S possibly damaging Het
Atg4b C A 1: 93,786,556 Q354K probably benign Het
Atxn2 T C 5: 121,802,143 S388P possibly damaging Het
C2cd3 T A 7: 100,422,507 probably benign Het
Cacna2d2 C A 9: 107,513,881 T403K probably damaging Het
Cap2 C T 13: 46,560,516 H79Y probably damaging Het
Car10 G T 11: 93,583,021 probably null Het
Ccno T C 13: 112,989,867 L290P probably damaging Het
Cfap69 T C 5: 5,589,303 K624E probably damaging Het
Ctnna3 A G 10: 64,586,130 M568V probably benign Het
Cyp1b1 C A 17: 79,713,774 V180L probably benign Het
Cyp2u1 G T 3: 131,295,552 probably null Het
Dcp1a T C 14: 30,519,679 probably null Het
Dnm1 C T 2: 32,320,581 G1S possibly damaging Het
Dnmt1 A G 9: 20,918,213 L698P probably damaging Het
Dock10 C A 1: 80,540,276 C1327F probably damaging Het
Dph3b-ps A G 13: 106,546,855 noncoding transcript Het
Dpyd G A 3: 119,427,226 D949N probably benign Het
Dync2li1 A G 17: 84,655,340 K345E possibly damaging Het
Eml2 T A 7: 19,182,259 probably null Het
Exoc7 A G 11: 116,294,401 probably benign Het
Faah A T 4: 116,005,692 C113* probably null Het
Fcf1 T A 12: 84,973,002 D16E probably benign Het
Fcgbp T C 7: 28,091,454 probably benign Het
Ghr A G 15: 3,319,891 S602P probably benign Het
Gm10334 A G 6: 41,443,369 I141T possibly damaging Het
Gm5114 T C 7: 39,408,809 D462G probably benign Het
Gm8186 T A 17: 26,099,026 S66C probably damaging Het
Gorab C T 1: 163,396,834 V133M probably benign Het
Gria1 G A 11: 57,309,884 probably null Het
Grik1 T A 16: 88,034,350 probably benign Het
Gtf3c1 A G 7: 125,681,104 L378P probably damaging Het
Htr5b A T 1: 121,527,546 V215D probably damaging Het
Htra1 A G 7: 130,979,478 T319A probably damaging Het
Idh2 C T 7: 80,098,257 A232T probably damaging Het
Klrb1a A C 6: 128,609,734 H189Q possibly damaging Het
Lhfp A G 3: 53,043,328 T8A probably benign Het
Ly75 T A 2: 60,306,404 Y1493F probably benign Het
Mfsd5 T C 15: 102,281,096 I301T possibly damaging Het
Mlkl C T 8: 111,333,350 E135K probably damaging Het
Mrgprx2 A C 7: 48,499,160 M1R probably null Het
Mroh2a G C 1: 88,246,042 A871P probably damaging Het
Mtbp A G 15: 55,611,029 I280V possibly damaging Het
Myo5c A T 9: 75,285,021 probably benign Het
Nos3 A G 5: 24,367,585 K174R probably damaging Het
Oas2 A T 5: 120,745,672 probably benign Het
Olfr889 T A 9: 38,115,770 probably null Het
Pi4kb G C 3: 94,984,740 E256Q probably benign Het
Pik3c2a T A 7: 116,373,744 I739F probably damaging Het
Pla2r1 T A 2: 60,432,601 K1031N probably benign Het
Plk4 A T 3: 40,812,884 probably benign Het
Polq T C 16: 37,029,430 C349R probably damaging Het
Polq G T 16: 37,089,317 E2354D probably damaging Het
Prss22 A G 17: 23,993,929 L278P probably damaging Het
Ptprk G A 10: 28,354,629 V239I possibly damaging Het
Raph1 T G 1: 60,510,496 probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ripor3 C T 2: 167,983,772 W755* probably null Het
Rnd3 G T 2: 51,148,231 D77E probably damaging Het
Ryr1 T C 7: 29,083,367 probably benign Het
Serpinb1a C T 13: 32,848,738 V63I probably benign Het
Six1 T G 12: 73,046,041 Y129S probably damaging Het
Spata31d1a G A 13: 59,703,501 T271I probably damaging Het
Stab1 T C 14: 31,148,101 D1387G probably benign Het
Stra6 T A 9: 58,153,183 M625K probably benign Het
Syne1 T C 10: 5,351,029 S900G probably benign Het
Tdpoz4 A C 3: 93,796,700 K101N probably benign Het
Tigd2 T C 6: 59,211,158 Y337H probably benign Het
Tnxb A G 17: 34,683,574 I1134V probably benign Het
Tspyl5 A G 15: 33,686,935 I288T probably damaging Het
Ulk1 A G 5: 110,788,797 V61A possibly damaging Het
Xxylt1 A G 16: 30,957,376 Y381H probably benign Het
Zcchc9 T A 13: 91,800,947 M12L probably benign Het
Zfp106 T C 2: 120,528,472 probably null Het
Zfp74 T A 7: 29,934,754 T510S probably benign Het
Zfp808 A G 13: 62,169,478 T14A probably damaging Het
Other mutations in Akap9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Akap9 APN 5 4046639 missense probably damaging 0.97
IGL00642:Akap9 APN 5 3960842 missense probably damaging 0.99
IGL00786:Akap9 APN 5 4070522 missense probably damaging 1.00
IGL00788:Akap9 APN 5 4060480 missense probably damaging 1.00
IGL00969:Akap9 APN 5 4001550 missense probably benign
IGL01014:Akap9 APN 5 3968683 missense probably benign 0.41
IGL01302:Akap9 APN 5 3970711 missense probably benign 0.27
IGL01610:Akap9 APN 5 4032839 missense possibly damaging 0.95
IGL01620:Akap9 APN 5 3960218 missense probably benign 0.11
IGL01862:Akap9 APN 5 3951705 missense probably damaging 0.99
IGL01862:Akap9 APN 5 4065856 missense probably damaging 0.99
IGL02151:Akap9 APN 5 4032728 nonsense probably null
IGL02635:Akap9 APN 5 4070500 missense possibly damaging 0.59
IGL02858:Akap9 APN 5 4069130 missense possibly damaging 0.88
IGL02967:Akap9 APN 5 3976164 missense probably benign 0.07
IGL03064:Akap9 APN 5 3968755 missense probably damaging 1.00
IGL03289:Akap9 APN 5 4077261 missense probably damaging 1.00
Wee_one UTSW 5 4043925 missense probably damaging 1.00
FR4449:Akap9 UTSW 5 3981214 unclassified probably benign
PIT1430001:Akap9 UTSW 5 4029849 missense probably damaging 1.00
PIT4366001:Akap9 UTSW 5 4046221 missense probably benign 0.24
R0088:Akap9 UTSW 5 3961946 missense probably benign 0.22
R0309:Akap9 UTSW 5 4069038 missense probably benign 0.01
R0440:Akap9 UTSW 5 4064569 missense probably damaging 0.99
R0441:Akap9 UTSW 5 3961714 missense probably benign 0.15
R0491:Akap9 UTSW 5 3972851 unclassified probably benign
R0501:Akap9 UTSW 5 3970685 missense probably damaging 1.00
R0507:Akap9 UTSW 5 4069043 missense probably benign 0.41
R0544:Akap9 UTSW 5 4069185 missense probably benign 0.22
R0581:Akap9 UTSW 5 4050620 missense probably benign 0.03
R0611:Akap9 UTSW 5 3954870 missense probably benign 0.00
R0620:Akap9 UTSW 5 4064136 missense probably damaging 0.98
R0639:Akap9 UTSW 5 4060318 missense probably damaging 1.00
R0932:Akap9 UTSW 5 4046492 missense possibly damaging 0.77
R0944:Akap9 UTSW 5 4064742 synonymous probably null
R1101:Akap9 UTSW 5 4046205 missense probably benign 0.00
R1159:Akap9 UTSW 5 3960865 missense probably damaging 0.98
R1170:Akap9 UTSW 5 4055671 missense probably benign
R1185:Akap9 UTSW 5 3948783 missense probably benign 0.13
R1185:Akap9 UTSW 5 3948783 missense probably benign 0.13
R1185:Akap9 UTSW 5 3948783 missense probably benign 0.13
R1453:Akap9 UTSW 5 3975614 unclassified probably null
R1551:Akap9 UTSW 5 4069174 missense probably benign 0.02
R1608:Akap9 UTSW 5 3961783 missense probably damaging 1.00
R1652:Akap9 UTSW 5 4077210 missense probably damaging 1.00
R1659:Akap9 UTSW 5 4064633 missense probably damaging 1.00
R1713:Akap9 UTSW 5 4039345 critical splice donor site probably null
R1719:Akap9 UTSW 5 3957645 nonsense probably null
R1720:Akap9 UTSW 5 3972791 missense possibly damaging 0.63
R1757:Akap9 UTSW 5 4001667 missense probably benign 0.41
R1872:Akap9 UTSW 5 4001406 missense probably damaging 1.00
R1876:Akap9 UTSW 5 3961809 missense probably benign 0.28
R1881:Akap9 UTSW 5 4050173 missense probably benign
R1950:Akap9 UTSW 5 3960677 missense probably damaging 1.00
R1980:Akap9 UTSW 5 3972771 missense probably damaging 0.99
R1993:Akap9 UTSW 5 4038520 splice site probably null
R2008:Akap9 UTSW 5 3960131 missense possibly damaging 0.47
R2020:Akap9 UTSW 5 3961967 missense probably damaging 1.00
R2051:Akap9 UTSW 5 3975685 nonsense probably null
R2061:Akap9 UTSW 5 3961010 missense probably damaging 1.00
R2109:Akap9 UTSW 5 4044847 missense possibly damaging 0.47
R2135:Akap9 UTSW 5 4064509 missense probably damaging 1.00
R2225:Akap9 UTSW 5 4077271 missense probably damaging 0.96
R2232:Akap9 UTSW 5 4046603 missense probably damaging 1.00
R2424:Akap9 UTSW 5 4065279 missense probably damaging 0.97
R2483:Akap9 UTSW 5 3976235 missense possibly damaging 0.65
R2879:Akap9 UTSW 5 3976353 intron probably benign
R3622:Akap9 UTSW 5 3976235 missense possibly damaging 0.65
R3623:Akap9 UTSW 5 3976235 missense possibly damaging 0.65
R3624:Akap9 UTSW 5 3976235 missense possibly damaging 0.65
R3722:Akap9 UTSW 5 4070351 missense probably damaging 1.00
R3806:Akap9 UTSW 5 3954410 missense probably benign 0.00
R3919:Akap9 UTSW 5 3961764 nonsense probably null
R4023:Akap9 UTSW 5 3992077 missense possibly damaging 0.66
R4093:Akap9 UTSW 5 4043996 missense probably damaging 0.99
R4434:Akap9 UTSW 5 4032708 missense probably damaging 0.99
R4529:Akap9 UTSW 5 4043948 missense probably damaging 1.00
R4530:Akap9 UTSW 5 4043948 missense probably damaging 1.00
R4532:Akap9 UTSW 5 4043948 missense probably damaging 1.00
R4533:Akap9 UTSW 5 4043948 missense probably damaging 1.00
R4585:Akap9 UTSW 5 3976151 missense probably benign 0.00
R4586:Akap9 UTSW 5 3976151 missense probably benign 0.00
R4655:Akap9 UTSW 5 4046403 missense probably benign 0.14
R4676:Akap9 UTSW 5 4032774 missense probably damaging 1.00
R4676:Akap9 UTSW 5 4064515 nonsense probably null
R4724:Akap9 UTSW 5 4055339 missense probably benign
R4731:Akap9 UTSW 5 3962266 missense possibly damaging 0.54
R4732:Akap9 UTSW 5 4013901 missense probably damaging 0.98
R4733:Akap9 UTSW 5 4013901 missense probably damaging 0.98
R4743:Akap9 UTSW 5 3961013 missense probably damaging 1.00
R4749:Akap9 UTSW 5 3968737 missense probably benign 0.41
R4756:Akap9 UTSW 5 4001418 missense probably damaging 0.99
R4757:Akap9 UTSW 5 4008382 missense probably damaging 1.00
R4860:Akap9 UTSW 5 4034916 intron probably benign
R4937:Akap9 UTSW 5 4050145 splice site probably null
R4960:Akap9 UTSW 5 3957664 missense probably benign 0.15
R4974:Akap9 UTSW 5 3961466 missense possibly damaging 0.81
R5101:Akap9 UTSW 5 4001748 missense probably damaging 0.96
R5160:Akap9 UTSW 5 4030007 missense probably damaging 1.00
R5200:Akap9 UTSW 5 3960734 missense probably benign 0.00
R5245:Akap9 UTSW 5 3976209 missense probably damaging 0.99
R5293:Akap9 UTSW 5 3948687 missense probably damaging 0.99
R5408:Akap9 UTSW 5 4058458 missense possibly damaging 0.84
R5507:Akap9 UTSW 5 3968683 missense probably benign 0.41
R5517:Akap9 UTSW 5 4001665 missense possibly damaging 0.76
R5579:Akap9 UTSW 5 4064714 missense possibly damaging 0.93
R5619:Akap9 UTSW 5 3954760 intron probably benign
R5645:Akap9 UTSW 5 4050590 missense probably benign 0.09
R5669:Akap9 UTSW 5 4050540 nonsense probably null
R5686:Akap9 UTSW 5 3971926 missense probably benign 0.00
R5697:Akap9 UTSW 5 3960170 missense possibly damaging 0.92
R5821:Akap9 UTSW 5 4046064 missense probably benign 0.13
R5875:Akap9 UTSW 5 4077285 missense probably benign 0.01
R5897:Akap9 UTSW 5 4077904 missense probably benign 0.23
R5999:Akap9 UTSW 5 4043925 missense probably damaging 1.00
R6025:Akap9 UTSW 5 4032801 missense probably damaging 1.00
R6078:Akap9 UTSW 5 4067924 critical splice donor site probably null
R6138:Akap9 UTSW 5 4067924 critical splice donor site probably null
R6225:Akap9 UTSW 5 3962105 missense probably damaging 1.00
R6243:Akap9 UTSW 5 4065000 intron probably null
R6326:Akap9 UTSW 5 3962061 missense probably damaging 1.00
R6564:Akap9 UTSW 5 4028491 missense probably damaging 0.98
R6617:Akap9 UTSW 5 3968745 missense probably benign 0.04
R6625:Akap9 UTSW 5 3968745 missense probably benign 0.04
R6632:Akap9 UTSW 5 4013842 splice site probably null
R6677:Akap9 UTSW 5 4029869 missense probably benign 0.21
R6717:Akap9 UTSW 5 4064086 missense probably damaging 1.00
R6893:Akap9 UTSW 5 3961709 missense probably benign 0.32
R6915:Akap9 UTSW 5 3960551 missense probably benign 0.03
R6938:Akap9 UTSW 5 4046628 missense possibly damaging 0.91
R6972:Akap9 UTSW 5 4046699 missense possibly damaging 0.62
R6973:Akap9 UTSW 5 4046699 missense possibly damaging 0.62
R6993:Akap9 UTSW 5 4065866 missense possibly damaging 0.65
R7032:Akap9 UTSW 5 3954896 missense probably benign
R7164:Akap9 UTSW 5 4060364 missense probably damaging 0.96
R7170:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7284:Akap9 UTSW 5 3956246 missense probably damaging 1.00
R7299:Akap9 UTSW 5 4032696 missense probably damaging 1.00
R7313:Akap9 UTSW 5 4004933 missense probably damaging 1.00
U15987:Akap9 UTSW 5 4067924 critical splice donor site probably null
X0026:Akap9 UTSW 5 4014039 missense probably damaging 1.00
X0057:Akap9 UTSW 5 3975598 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CCACTGACCTCATGGTCAATACTGGAA -3'
(R):5'- CTGGAAACCAAGCATTTATGCTGTTGTT -3'

Sequencing Primer
(F):5'- ctgagccgtttctctagcc -3'
(R):5'- GTATTTACCGAAATGCAACAGAGC -3'
Posted On2013-04-24