Incidental Mutation 'R4023:Acad8'
ID313350
Institutional Source Beutler Lab
Gene Symbol Acad8
Ensembl Gene ENSMUSG00000031969
Gene Nameacyl-Coenzyme A dehydrogenase family, member 8
Synonyms
MMRRC Submission 040957-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R4023 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location26974135-26999566 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26979185 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 276 (I276V)
Ref Sequence ENSEMBL: ENSMUSP00000112908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060513] [ENSMUST00000120367] [ENSMUST00000128923] [ENSMUST00000132293]
Predicted Effect probably benign
Transcript: ENSMUST00000060513
AA Change: I276V

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000054370
Gene: ENSMUSG00000031969
AA Change: I276V

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_N 40 151 1e-28 PFAM
Pfam:Acyl-CoA_dh_M 155 207 1.8e-23 PFAM
Pfam:Acyl-CoA_dh_1 261 411 2.9e-47 PFAM
Pfam:Acyl-CoA_dh_2 276 399 1.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120367
AA Change: I276V

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000112908
Gene: ENSMUSG00000031969
AA Change: I276V

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_N 40 151 7.8e-29 PFAM
Pfam:Acyl-CoA_dh_M 155 249 3.7e-28 PFAM
Pfam:Acyl-CoA_dh_1 261 411 5.7e-45 PFAM
Pfam:Acyl-CoA_dh_2 276 400 2.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128923
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129490
Predicted Effect probably benign
Transcript: ENSMUST00000132293
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151075
Predicted Effect probably benign
Transcript: ENSMUST00000215693
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the acyl-CoA dehydrogenase family of enzymes that catalyze the dehydrogenation of acyl-CoA derivatives in the metabolism of fatty acids or branch chained amino acids. The encoded protein is a mitochondrial enzyme that functions in catabolism of the branched-chain amino acid valine. Defects in this gene are the cause of isobutyryl-CoA dehydrogenase deficiency.[provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit cold intolerance at young age with a progressive hepatic steatosis and abnormal mitochondria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110038F14Rik CGGG CGGGGGG 15: 76,949,663 probably benign Het
Adgrg7 A T 16: 56,730,298 Y684N probably damaging Het
Akap9 C T 5: 3,992,077 T1370I possibly damaging Het
Akna C G 4: 63,374,390 G1094A probably benign Het
Catsperb C A 12: 101,602,683 Y871* probably null Het
Ccdc105 T C 10: 78,752,893 T28A probably benign Het
Clcn4 T G 7: 7,290,428 Y443S probably damaging Het
Clcn6 T A 4: 148,014,283 T463S possibly damaging Het
Colec10 A G 15: 54,462,551 D259G probably damaging Het
Ctnna2 A T 6: 77,636,844 D254E possibly damaging Het
Depdc1a G A 3: 159,516,149 probably null Het
Dlec1 T C 9: 119,137,340 Y1126H probably damaging Het
Fam208b T C 13: 3,584,554 D751G probably damaging Het
Fezf2 A T 14: 12,343,986 C302S probably damaging Het
Flnc T C 6: 29,451,635 I1591T possibly damaging Het
Kidins220 A G 12: 25,057,144 probably null Het
Mctp2 C A 7: 72,090,239 C801F possibly damaging Het
Myo1e A G 9: 70,324,875 I229V probably benign Het
Olfr1102 A T 2: 87,002,922 K318* probably null Het
Olfr895 G A 9: 38,269,461 C308Y possibly damaging Het
Ppp3r1 T C 11: 17,194,786 V133A probably damaging Het
Rif1 T A 2: 52,121,087 Y2389N probably benign Het
Sidt1 A G 16: 44,281,886 S304P possibly damaging Het
Siglecf T A 7: 43,355,571 S408R possibly damaging Het
Stat5a T A 11: 100,874,926 C279* probably null Het
Tas2r105 A G 6: 131,686,826 V213A probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Usp46 A G 5: 74,032,475 Y47H probably damaging Het
Vmn1r34 T A 6: 66,637,704 M17L probably benign Het
Vmn2r120 T A 17: 57,536,718 D42V possibly damaging Het
Wdr20 A G 12: 110,793,516 T279A probably benign Het
Zfyve1 A G 12: 83,594,522 V120A probably benign Het
Other mutations in Acad8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Acad8 APN 9 26990594 missense probably damaging 1.00
IGL01721:Acad8 APN 9 26992267 splice site probably benign
R1473:Acad8 UTSW 9 26979041 missense probably benign 0.00
R2102:Acad8 UTSW 9 26985565 nonsense probably null
R3030:Acad8 UTSW 9 26979059 missense probably benign 0.04
R4276:Acad8 UTSW 9 26978449 missense probably null 0.47
R4667:Acad8 UTSW 9 26990627 missense probably damaging 1.00
R4668:Acad8 UTSW 9 26990627 missense probably damaging 1.00
R4669:Acad8 UTSW 9 26990627 missense probably damaging 1.00
R4898:Acad8 UTSW 9 26978402 missense probably damaging 1.00
R5418:Acad8 UTSW 9 26985557 missense probably damaging 1.00
R5486:Acad8 UTSW 9 26999495 start codon destroyed probably null
R5549:Acad8 UTSW 9 26985551 missense probably damaging 1.00
R5887:Acad8 UTSW 9 26979324 splice site probably null
R5943:Acad8 UTSW 9 26999444 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAAGTGCAGATCCTAGGTAAC -3'
(R):5'- TGCTTGGGGAATCATAGGGC -3'

Sequencing Primer
(F):5'- AAGGTGCTCCAAACTGCTTG -3'
(R):5'- CAGCCATCAAGACCCTGATTTTTG -3'
Posted On2015-04-30