Incidental Mutation 'R4024:Dzank1'
ID313376
Institutional Source Beutler Lab
Gene Symbol Dzank1
Ensembl Gene ENSMUSG00000037259
Gene Namedouble zinc ribbon and ankyrin repeat domains 1
Synonyms2810039F03Rik, 6330439K17Rik, Ankrd64
MMRRC Submission 041612-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4024 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location144470557-144527414 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 144482227 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 565 (S565G)
Ref Sequence ENSEMBL: ENSMUSP00000133177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081982] [ENSMUST00000163701]
Predicted Effect probably benign
Transcript: ENSMUST00000081982
AA Change: S564G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000080643
Gene: ENSMUSG00000037259
AA Change: S564G

DomainStartEndE-ValueType
Pfam:CHB_HEX_C 11 99 1.1e-16 PFAM
Pfam:CHB_HEX_C_1 20 97 4.5e-18 PFAM
Pfam:Fn3_assoc 32 100 1.6e-17 PFAM
ZnF_RBZ 268 292 5.44e0 SMART
ZnF_RBZ 307 331 2.55e0 SMART
Blast:ZnF_RBZ 355 378 1e-7 BLAST
ZnF_RBZ 385 409 3.13e0 SMART
low complexity region 591 604 N/A INTRINSIC
ANK 631 662 2.97e2 SMART
ANK 666 695 2.83e0 SMART
Blast:ANK 700 731 7e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149523
Predicted Effect probably benign
Transcript: ENSMUST00000163701
AA Change: S565G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133177
Gene: ENSMUSG00000037259
AA Change: S565G

DomainStartEndE-ValueType
Pfam:CHB_HEX_C 12 99 1.5e-17 PFAM
Pfam:CHB_HEX_C_1 21 97 8.5e-17 PFAM
Pfam:Fn3_assoc 32 100 3.7e-18 PFAM
ZnF_RBZ 269 293 5.44e0 SMART
ZnF_RBZ 308 332 2.55e0 SMART
Blast:ZnF_RBZ 356 379 1e-7 BLAST
ZnF_RBZ 386 410 3.13e0 SMART
low complexity region 592 605 N/A INTRINSIC
ANK 632 663 2.97e2 SMART
ANK 667 696 2.83e0 SMART
Blast:ANK 701 732 7e-12 BLAST
Meta Mutation Damage Score 0.1244 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene contains two ankyrin repeat-encoding regions. Ankyrin repeats are tandemly repeated modules of about 33 amino acids described as L-shaped structures consisting of a beta-hairpin and two alpha-helices. Ankyrin repeats occur in a large number of functionally diverse proteins, mainly from eukaryotes, and are known to function as protein-protein interaction domains. Alternative splicing has been observed for this gene but the full-length nature of additional variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 A G 12: 80,168,477 Y842H probably damaging Het
Adamts9 A G 6: 92,872,784 probably benign Het
Adgrg7 A T 16: 56,730,298 Y684N probably damaging Het
Aoc1 A T 6: 48,908,269 N646I probably damaging Het
Armc2 A G 10: 41,993,058 S37P probably benign Het
Bhmt2 G A 13: 93,663,331 probably benign Het
Bpifb1 A T 2: 154,213,046 D286V probably damaging Het
Cadps T A 14: 12,705,539 E285D probably damaging Het
Cap2 C T 13: 46,637,841 probably benign Het
Clcn4 T G 7: 7,290,428 Y443S probably damaging Het
Clcn6 T A 4: 148,014,283 T463S possibly damaging Het
Cmip A G 8: 117,447,416 I412V possibly damaging Het
Cndp1 T C 18: 84,628,813 D250G probably damaging Het
Colec10 A G 15: 54,462,551 D259G probably damaging Het
Ctnna2 A T 6: 77,636,844 D254E possibly damaging Het
Dlec1 T C 9: 119,137,340 Y1126H probably damaging Het
Eef2k A G 7: 120,858,598 Y60C probably benign Het
Fam208b T C 13: 3,584,554 D751G probably damaging Het
Fbxl4 T C 4: 22,377,074 V170A possibly damaging Het
Foxk2 T A 11: 121,285,613 I195N possibly damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gpr6 G A 10: 41,071,268 T106M probably damaging Het
Grk3 T A 5: 112,914,984 N666Y possibly damaging Het
Hnmt T C 2: 24,003,765 D239G probably benign Het
Igf2 A G 7: 142,654,307 V111A probably benign Het
Lrriq3 G A 3: 155,188,302 E547K probably benign Het
Lrriq4 T C 3: 30,650,273 V150A possibly damaging Het
Mroh8 A G 2: 157,256,352 V292A probably benign Het
Myo1e A G 9: 70,324,875 I229V probably benign Het
Nisch A G 14: 31,176,819 probably benign Het
Nkx2-2 T C 2: 147,184,234 T195A probably benign Het
Olfr1132 T A 2: 87,635,155 L197F probably damaging Het
Olfr328 G A 11: 58,551,396 T281I possibly damaging Het
Olfr432 C T 1: 174,051,117 T248I probably benign Het
Olfr487 A T 7: 108,211,742 Y262* probably null Het
Plekhn1 A G 4: 156,224,750 V233A probably damaging Het
Ppp3r1 T C 11: 17,194,786 V133A probably damaging Het
Sash1 T C 10: 8,729,917 D903G probably benign Het
Scn8a A G 15: 101,039,793 D1681G probably damaging Het
Slk A G 19: 47,622,370 probably null Het
Tlr11 C T 14: 50,362,846 T763I probably benign Het
Ttbk2 T C 2: 120,760,255 T308A possibly damaging Het
Tyk2 G A 9: 21,115,919 L552F probably damaging Het
Ubp1 A G 9: 113,944,883 D50G probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ulk4 A T 9: 121,044,849 I1172N possibly damaging Het
Usf3 T A 16: 44,216,165 V336E possibly damaging Het
Vangl2 T C 1: 172,008,041 S355G probably benign Het
Vmn1r216 A G 13: 23,099,891 D248G probably damaging Het
Vmn1r34 T A 6: 66,637,704 M17L probably benign Het
Vmn2r120 T A 17: 57,536,718 D42V possibly damaging Het
Vmn2r6 A T 3: 64,538,250 S685T possibly damaging Het
Vsig10l T C 7: 43,468,086 V701A probably benign Het
Wdfy3 A G 5: 101,924,095 probably benign Het
Zfp808 T A 13: 62,171,730 C258S possibly damaging Het
Zfp988 A C 4: 147,332,785 K559Q probably benign Het
Other mutations in Dzank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Dzank1 APN 2 144481725 nonsense probably null
IGL00955:Dzank1 APN 2 144490174 missense probably benign 0.22
IGL01888:Dzank1 APN 2 144476154 splice site probably null
IGL02108:Dzank1 APN 2 144506223 missense probably benign 0.02
IGL02979:Dzank1 APN 2 144488738 missense probably damaging 1.00
PIT4466001:Dzank1 UTSW 2 144483373 missense probably benign 0.00
R0388:Dzank1 UTSW 2 144476106 missense possibly damaging 0.86
R0603:Dzank1 UTSW 2 144511512 missense probably benign 0.04
R1052:Dzank1 UTSW 2 144513445 missense probably benign
R1386:Dzank1 UTSW 2 144491831 missense probably benign 0.05
R1529:Dzank1 UTSW 2 144482188 missense probably benign 0.01
R1634:Dzank1 UTSW 2 144481669 missense probably benign 0.01
R2761:Dzank1 UTSW 2 144513449 missense probably benign
R4279:Dzank1 UTSW 2 144491845 missense probably benign 0.00
R4324:Dzank1 UTSW 2 144488698 missense possibly damaging 0.95
R4516:Dzank1 UTSW 2 144510122 intron probably benign
R4713:Dzank1 UTSW 2 144491804 missense probably benign 0.13
R4782:Dzank1 UTSW 2 144504399 missense probably damaging 1.00
R4994:Dzank1 UTSW 2 144522566 missense probably damaging 1.00
R5157:Dzank1 UTSW 2 144483412 missense probably damaging 0.98
R5514:Dzank1 UTSW 2 144481685 missense probably benign 0.01
R5580:Dzank1 UTSW 2 144506178 missense probably damaging 1.00
R5635:Dzank1 UTSW 2 144483407 missense probably damaging 1.00
R5793:Dzank1 UTSW 2 144506224 missense probably benign 0.14
R5820:Dzank1 UTSW 2 144513488 missense probably damaging 1.00
R5976:Dzank1 UTSW 2 144501489 missense probably damaging 1.00
R6935:Dzank1 UTSW 2 144476094 missense possibly damaging 0.64
R6980:Dzank1 UTSW 2 144490136 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- CCAGAGAAATACGCTGCCTG -3'
(R):5'- CCTGGAGATATAACTTAGTGGCAG -3'

Sequencing Primer
(F):5'- TACGCTGCCTGAAACATGGTG -3'
(R):5'- AGTGGCAGACTGGTTGCATAC -3'
Posted On2015-04-30