Incidental Mutation 'R4024:Ugcg'
ID313385
Institutional Source Beutler Lab
Gene Symbol Ugcg
Ensembl Gene ENSMUSG00000028381
Gene NameUDP-glucose ceramide glucosyltransferase
SynonymsEpcs21, Ugcgl, GlcT-1
MMRRC Submission 041612-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4024 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location59189257-59222833 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 59207798 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 46 (P46S)
Ref Sequence ENSEMBL: ENSMUSP00000030074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030074]
Predicted Effect probably benign
Transcript: ENSMUST00000030074
AA Change: P46S

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000030074
Gene: ENSMUSG00000028381
AA Change: P46S

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 51 278 1.3e-26 PFAM
Pfam:Glyco_transf_21 106 278 8.4e-61 PFAM
Pfam:Glyco_trans_2_3 139 368 9.6e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133996
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155153
Meta Mutation Damage Score 0.124 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes the first glycosylation step in the biosynthesis of glycosphingolipids, which are membrane components containing lipid and sugar moieties. The product of this reaction is glucosylceramide, which is the core structure of many glycosphingolipids. [provided by RefSeq, Dec 2014]
PHENOTYPE: At embryonic day 7.5, embryos homozygous for a null mutation exhibit decreased size, markedly reduced extraembryonic tissues and a large increase in cells undergoing apoptosis. Mutants die by embryonic day 8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 A G 12: 80,168,477 Y842H probably damaging Het
Adamts9 A G 6: 92,872,784 probably benign Het
Adgrg7 A T 16: 56,730,298 Y684N probably damaging Het
Aoc1 A T 6: 48,908,269 N646I probably damaging Het
Armc2 A G 10: 41,993,058 S37P probably benign Het
Bhmt2 G A 13: 93,663,331 probably benign Het
Bpifb1 A T 2: 154,213,046 D286V probably damaging Het
Cadps T A 14: 12,705,539 E285D probably damaging Het
Cap2 C T 13: 46,637,841 probably benign Het
Clcn4 T G 7: 7,290,428 Y443S probably damaging Het
Clcn6 T A 4: 148,014,283 T463S possibly damaging Het
Cmip A G 8: 117,447,416 I412V possibly damaging Het
Cndp1 T C 18: 84,628,813 D250G probably damaging Het
Colec10 A G 15: 54,462,551 D259G probably damaging Het
Ctnna2 A T 6: 77,636,844 D254E possibly damaging Het
Dlec1 T C 9: 119,137,340 Y1126H probably damaging Het
Dzank1 T C 2: 144,482,227 S565G probably benign Het
Eef2k A G 7: 120,858,598 Y60C probably benign Het
Fam208b T C 13: 3,584,554 D751G probably damaging Het
Fbxl4 T C 4: 22,377,074 V170A possibly damaging Het
Foxk2 T A 11: 121,285,613 I195N possibly damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gpr6 G A 10: 41,071,268 T106M probably damaging Het
Grk3 T A 5: 112,914,984 N666Y possibly damaging Het
Hnmt T C 2: 24,003,765 D239G probably benign Het
Igf2 A G 7: 142,654,307 V111A probably benign Het
Lrriq3 G A 3: 155,188,302 E547K probably benign Het
Lrriq4 T C 3: 30,650,273 V150A possibly damaging Het
Mroh8 A G 2: 157,256,352 V292A probably benign Het
Myo1e A G 9: 70,324,875 I229V probably benign Het
Nisch A G 14: 31,176,819 probably benign Het
Nkx2-2 T C 2: 147,184,234 T195A probably benign Het
Olfr1132 T A 2: 87,635,155 L197F probably damaging Het
Olfr328 G A 11: 58,551,396 T281I possibly damaging Het
Olfr432 C T 1: 174,051,117 T248I probably benign Het
Olfr487 A T 7: 108,211,742 Y262* probably null Het
Plekhn1 A G 4: 156,224,750 V233A probably damaging Het
Ppp3r1 T C 11: 17,194,786 V133A probably damaging Het
Sash1 T C 10: 8,729,917 D903G probably benign Het
Scn8a A G 15: 101,039,793 D1681G probably damaging Het
Slk A G 19: 47,622,370 probably null Het
Tlr11 C T 14: 50,362,846 T763I probably benign Het
Ttbk2 T C 2: 120,760,255 T308A possibly damaging Het
Tyk2 G A 9: 21,115,919 L552F probably damaging Het
Ubp1 A G 9: 113,944,883 D50G probably benign Het
Ulk4 A T 9: 121,044,849 I1172N possibly damaging Het
Usf3 T A 16: 44,216,165 V336E possibly damaging Het
Vangl2 T C 1: 172,008,041 S355G probably benign Het
Vmn1r216 A G 13: 23,099,891 D248G probably damaging Het
Vmn1r34 T A 6: 66,637,704 M17L probably benign Het
Vmn2r120 T A 17: 57,536,718 D42V possibly damaging Het
Vmn2r6 A T 3: 64,538,250 S685T possibly damaging Het
Vsig10l T C 7: 43,468,086 V701A probably benign Het
Wdfy3 A G 5: 101,924,095 probably benign Het
Zfp808 T A 13: 62,171,730 C258S possibly damaging Het
Zfp988 A C 4: 147,332,785 K559Q probably benign Het
Other mutations in Ugcg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01447:Ugcg APN 4 59213865 missense possibly damaging 0.94
IGL01768:Ugcg APN 4 59217216 critical splice donor site probably null
IGL02636:Ugcg APN 4 59207763 missense possibly damaging 0.73
IGL02672:Ugcg APN 4 59218587 splice site probably benign
IGL02798:Ugcg APN 4 59220346 missense probably damaging 1.00
R0013:Ugcg UTSW 4 59213931 missense possibly damaging 0.82
R0013:Ugcg UTSW 4 59213931 missense possibly damaging 0.82
R0068:Ugcg UTSW 4 59217130 missense probably benign 0.16
R0068:Ugcg UTSW 4 59217130 missense probably benign 0.16
R0119:Ugcg UTSW 4 59217036 missense possibly damaging 0.85
R0230:Ugcg UTSW 4 59189739 nonsense probably null
R0299:Ugcg UTSW 4 59217036 missense possibly damaging 0.85
R0384:Ugcg UTSW 4 59220387 missense possibly damaging 0.91
R0499:Ugcg UTSW 4 59217036 missense possibly damaging 0.85
R0645:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0688:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0726:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0802:Ugcg UTSW 4 59189685 missense probably benign 0.00
R0803:Ugcg UTSW 4 59189685 missense probably benign 0.00
R0811:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0812:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0828:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0831:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0944:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0945:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0947:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1104:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1209:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1210:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1252:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1253:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1255:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1488:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1490:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1548:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1698:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1771:Ugcg UTSW 4 59207775 missense probably benign 0.05
R1776:Ugcg UTSW 4 59207775 missense probably benign 0.05
R1781:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1794:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1840:Ugcg UTSW 4 59219517 missense probably damaging 1.00
R1942:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2228:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2229:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2237:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2239:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2314:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2337:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2338:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2340:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2422:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2426:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2433:Ugcg UTSW 4 59207876 missense possibly damaging 0.89
R2680:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3076:Ugcg UTSW 4 59213922 missense probably damaging 1.00
R3078:Ugcg UTSW 4 59213922 missense probably damaging 1.00
R3689:Ugcg UTSW 4 59211883 missense probably benign 0.16
R3732:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3732:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3733:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3766:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3767:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3768:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3769:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3771:Ugcg UTSW 4 59189690 missense probably benign
R3847:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3848:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3916:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3917:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3958:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3959:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4023:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4025:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4065:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4066:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4427:Ugcg UTSW 4 59219555 missense probably benign 0.02
R5842:Ugcg UTSW 4 59219545 missense possibly damaging 0.93
R6012:Ugcg UTSW 4 59220272 missense probably damaging 0.96
R6080:Ugcg UTSW 4 59218524 missense possibly damaging 0.70
R6762:Ugcg UTSW 4 59219530 missense possibly damaging 0.86
Y4336:Ugcg UTSW 4 59207798 missense probably benign 0.17
Y4337:Ugcg UTSW 4 59207798 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- AAACAAAAGCCTCTTCCTTGAG -3'
(R):5'- CCTCATACAGTGTTAAAATTCCCC -3'

Sequencing Primer
(F):5'- TTCCTTGAGGTGCCCAGC -3'
(R):5'- CCAAATAAATAAGTAAGCCCACGATG -3'
Posted On2015-04-30