Incidental Mutation 'R4031:Zfp236'
ID313513
Institutional Source Beutler Lab
Gene Symbol Zfp236
Ensembl Gene ENSMUSG00000041258
Gene Namezinc finger protein 236
SynonymsLOC240456
MMRRC Submission 040960-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.719) question?
Stock #R4031 (G1)
Quality Score136
Status Validated
Chromosome18
Chromosomal Location82593593-82692883 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 82624465 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 1052 (E1052V)
Ref Sequence ENSEMBL: ENSMUSP00000130004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171071] [ENSMUST00000182122] [ENSMUST00000183048]
Predicted Effect probably damaging
Transcript: ENSMUST00000171071
AA Change: E1052V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000130004
Gene: ENSMUSG00000041258
AA Change: E1052V

DomainStartEndE-ValueType
ZnF_C2H2 39 61 2.24e-3 SMART
ZnF_C2H2 68 90 2.29e0 SMART
ZnF_C2H2 95 117 1.26e-2 SMART
ZnF_C2H2 123 145 6.67e-2 SMART
ZnF_C2H2 155 177 6.42e-4 SMART
ZnF_C2H2 199 221 1.75e-5 SMART
ZnF_C2H2 227 249 1.52e-5 SMART
ZnF_C2H2 255 278 8.94e-3 SMART
low complexity region 290 309 N/A INTRINSIC
low complexity region 403 426 N/A INTRINSIC
ZnF_C2H2 436 458 1.98e-4 SMART
ZnF_C2H2 464 486 9.58e-3 SMART
ZnF_C2H2 492 514 6.42e-4 SMART
ZnF_C2H2 520 542 1.18e-2 SMART
low complexity region 592 605 N/A INTRINSIC
ZnF_C2H2 611 633 1.62e0 SMART
ZnF_C2H2 639 661 5.21e-4 SMART
ZnF_C2H2 667 689 6.78e-3 SMART
ZnF_C2H2 695 717 7.37e-4 SMART
low complexity region 720 733 N/A INTRINSIC
ZnF_C2H2 922 944 5.21e-4 SMART
ZnF_C2H2 950 972 1.04e-3 SMART
ZnF_C2H2 978 1000 8.6e-5 SMART
ZnF_C2H2 1006 1028 2.75e-3 SMART
low complexity region 1030 1039 N/A INTRINSIC
ZnF_C2H2 1122 1144 7.78e-3 SMART
ZnF_C2H2 1150 1172 3.63e-3 SMART
ZnF_C2H2 1178 1200 6.88e-4 SMART
ZnF_C2H2 1206 1228 5.42e-2 SMART
low complexity region 1243 1258 N/A INTRINSIC
low complexity region 1462 1477 N/A INTRINSIC
ZnF_C2H2 1612 1635 7.15e-2 SMART
ZnF_C2H2 1641 1663 2.91e-2 SMART
ZnF_C2H2 1677 1699 7.26e-3 SMART
ZnF_C2H2 1705 1727 1.84e-4 SMART
ZnF_C2H2 1733 1756 2.95e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182122
AA Change: E1100V

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138557
Gene: ENSMUSG00000041258
AA Change: E1100V

DomainStartEndE-ValueType
ZnF_C2H2 39 61 2.24e-3 SMART
ZnF_C2H2 68 90 2.29e0 SMART
ZnF_C2H2 95 117 1.26e-2 SMART
ZnF_C2H2 123 145 6.67e-2 SMART
ZnF_C2H2 155 177 6.42e-4 SMART
ZnF_C2H2 199 221 1.75e-5 SMART
ZnF_C2H2 227 249 1.52e-5 SMART
ZnF_C2H2 255 278 8.94e-3 SMART
ZnF_C2H2 287 310 9.58e-3 SMART
low complexity region 338 357 N/A INTRINSIC
low complexity region 451 474 N/A INTRINSIC
ZnF_C2H2 484 506 1.98e-4 SMART
ZnF_C2H2 512 534 9.58e-3 SMART
ZnF_C2H2 540 562 6.42e-4 SMART
ZnF_C2H2 568 590 1.18e-2 SMART
low complexity region 640 653 N/A INTRINSIC
ZnF_C2H2 659 681 1.62e0 SMART
ZnF_C2H2 687 709 5.21e-4 SMART
ZnF_C2H2 715 737 6.78e-3 SMART
ZnF_C2H2 743 765 7.37e-4 SMART
low complexity region 768 781 N/A INTRINSIC
ZnF_C2H2 970 992 5.21e-4 SMART
ZnF_C2H2 998 1020 1.04e-3 SMART
ZnF_C2H2 1026 1048 8.6e-5 SMART
ZnF_C2H2 1054 1076 2.75e-3 SMART
low complexity region 1078 1087 N/A INTRINSIC
ZnF_C2H2 1170 1192 7.78e-3 SMART
ZnF_C2H2 1198 1220 3.63e-3 SMART
ZnF_C2H2 1226 1248 6.88e-4 SMART
ZnF_C2H2 1254 1276 5.42e-2 SMART
low complexity region 1291 1306 N/A INTRINSIC
low complexity region 1510 1525 N/A INTRINSIC
ZnF_C2H2 1660 1683 7.15e-2 SMART
ZnF_C2H2 1689 1711 2.91e-2 SMART
ZnF_C2H2 1725 1747 7.26e-3 SMART
ZnF_C2H2 1753 1775 1.84e-4 SMART
ZnF_C2H2 1781 1804 2.95e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183048
SMART Domains Protein: ENSMUSP00000138179
Gene: ENSMUSG00000041258

DomainStartEndE-ValueType
ZnF_C2H2 39 61 2.24e-3 SMART
ZnF_C2H2 68 90 2.29e0 SMART
ZnF_C2H2 95 117 1.26e-2 SMART
ZnF_C2H2 123 145 6.67e-2 SMART
ZnF_C2H2 155 177 6.42e-4 SMART
ZnF_C2H2 199 221 1.75e-5 SMART
ZnF_C2H2 227 249 1.52e-5 SMART
ZnF_C2H2 255 278 8.94e-3 SMART
ZnF_C2H2 287 310 9.58e-3 SMART
low complexity region 338 357 N/A INTRINSIC
low complexity region 454 467 N/A INTRINSIC
Meta Mutation Damage Score 0.096 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 95% (52/55)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 G T 8: 86,517,448 F1025L probably damaging Het
Acss2 C T 2: 155,557,210 T477I probably damaging Het
Aplp2 G A 9: 31,157,730 P601L probably benign Het
Arl2bp T C 8: 94,667,653 I32T probably damaging Het
Avpi1 C A 19: 42,124,741 probably benign Het
C030005K15Rik T C 10: 97,725,542 Y109C unknown Het
Ccdc150 T A 1: 54,278,811 M303K probably benign Het
Chrna5 T C 9: 54,998,086 W61R probably damaging Het
Copa T C 1: 172,108,375 V428A probably damaging Het
Crybb3 A G 5: 113,079,869 Y29H probably damaging Het
Dcun1d4 A G 5: 73,534,637 D89G probably damaging Het
Disp2 T C 2: 118,791,880 I1031T probably benign Het
Elf1 A C 14: 79,569,283 K161Q probably damaging Het
Fndc1 A T 17: 7,769,752 Y1159* probably null Het
Hspa12a T C 19: 58,800,857 N449S probably benign Het
Hyal4 A G 6: 24,756,224 E147G probably damaging Het
Hydin T C 8: 110,610,047 I5152T probably benign Het
Ighv9-1 C T 12: 114,094,224 A19T probably benign Het
Kcnt1 T G 2: 25,916,048 S1216R possibly damaging Het
Kdm5d T A Y: 916,910 V435E probably damaging Het
Klhl30 G A 1: 91,361,157 R546H probably benign Het
Lrp1b C T 2: 40,702,848 G3753D probably benign Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Macf1 A G 4: 123,381,312 L6303P probably damaging Het
Mblac2 T C 13: 81,750,089 S195P possibly damaging Het
Mindy3 A C 2: 12,401,083 probably null Het
Neurod1 C T 2: 79,454,026 D338N probably benign Het
Polr1e A T 4: 45,018,685 E5V probably benign Het
Polr2b G A 5: 77,348,405 R1141H possibly damaging Het
Ppp2r2a T C 14: 67,028,976 S79G probably damaging Het
Psmd2 G A 16: 20,663,205 G896D probably damaging Het
Rap1gds1 T C 3: 139,050,592 probably benign Het
Rsph10b A G 5: 143,985,668 probably null Het
Slc26a10 A G 10: 127,178,002 V297A possibly damaging Het
Slc26a5 T C 5: 21,847,191 K47E probably damaging Het
Slurp1 T C 15: 74,727,487 E58G probably damaging Het
Spo11 T A 2: 172,986,832 probably benign Het
Tm9sf4 T C 2: 153,198,344 probably benign Het
Trak1 T C 9: 121,451,670 I272T probably damaging Het
Tshz1 T C 18: 84,014,829 K485E possibly damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Unc79 T A 12: 103,072,759 S671T possibly damaging Het
Usp43 G T 11: 67,913,833 A186D probably damaging Het
Vmn2r107 G A 17: 20,375,221 V679I probably benign Het
Vsig10l C T 7: 43,465,374 A333V probably damaging Het
Vwa3a G A 7: 120,768,232 probably null Het
Wdr49 C A 3: 75,323,665 L563F probably benign Het
Wnk1 T C 6: 119,951,068 T1141A probably damaging Het
Zfp317 A T 9: 19,646,712 H163L possibly damaging Het
Zfp975 G A 7: 42,662,953 Q79* probably null Het
Other mutations in Zfp236
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01016:Zfp236 APN 18 82668690 missense probably benign 0.44
IGL01760:Zfp236 APN 18 82621422 missense probably damaging 1.00
IGL01923:Zfp236 APN 18 82682219 missense probably damaging 0.98
IGL01934:Zfp236 APN 18 82633120 missense probably damaging 0.99
IGL01949:Zfp236 APN 18 82624396 missense probably damaging 1.00
IGL02063:Zfp236 APN 18 82658151 missense probably benign
IGL02496:Zfp236 APN 18 82629992 missense probably damaging 1.00
IGL02513:Zfp236 APN 18 82630114 missense probably damaging 1.00
IGL02626:Zfp236 APN 18 82657995 splice site probably benign
IGL02880:Zfp236 APN 18 82624459 missense probably benign 0.15
IGL03156:Zfp236 APN 18 82680702 missense probably damaging 1.00
IGL03261:Zfp236 APN 18 82630608 missense possibly damaging 0.93
R0047:Zfp236 UTSW 18 82680692 missense probably damaging 1.00
R0052:Zfp236 UTSW 18 82639332 missense probably damaging 1.00
R0194:Zfp236 UTSW 18 82656987 missense probably damaging 1.00
R0207:Zfp236 UTSW 18 82640227 missense probably damaging 1.00
R0234:Zfp236 UTSW 18 82629994 missense probably damaging 1.00
R0234:Zfp236 UTSW 18 82629994 missense probably damaging 1.00
R0302:Zfp236 UTSW 18 82658088 missense probably damaging 0.99
R0730:Zfp236 UTSW 18 82640244 splice site probably benign
R0755:Zfp236 UTSW 18 82620332 missense probably damaging 1.00
R1202:Zfp236 UTSW 18 82628166 missense probably benign 0.00
R1449:Zfp236 UTSW 18 82646005 missense probably damaging 1.00
R1550:Zfp236 UTSW 18 82674424 missense possibly damaging 0.81
R1785:Zfp236 UTSW 18 82621304 missense probably benign 0.08
R1786:Zfp236 UTSW 18 82621304 missense probably benign 0.08
R2042:Zfp236 UTSW 18 82633109 missense probably damaging 1.00
R2132:Zfp236 UTSW 18 82621304 missense probably benign 0.08
R2133:Zfp236 UTSW 18 82621304 missense probably benign 0.08
R2247:Zfp236 UTSW 18 82604298 missense possibly damaging 0.82
R2484:Zfp236 UTSW 18 82668637 missense probably benign 0.05
R3715:Zfp236 UTSW 18 82632970 splice site probably benign
R4003:Zfp236 UTSW 18 82680745 nonsense probably null
R4482:Zfp236 UTSW 18 82644221 missense probably benign 0.04
R4492:Zfp236 UTSW 18 82630000 missense probably damaging 1.00
R4502:Zfp236 UTSW 18 82636954 missense probably benign 0.13
R4561:Zfp236 UTSW 18 82620406 missense probably damaging 1.00
R4649:Zfp236 UTSW 18 82597659 missense probably damaging 1.00
R4902:Zfp236 UTSW 18 82609418 missense possibly damaging 0.89
R5064:Zfp236 UTSW 18 82691576 critical splice donor site probably null
R5084:Zfp236 UTSW 18 82609431 missense probably damaging 1.00
R5090:Zfp236 UTSW 18 82618881 missense probably benign 0.08
R5191:Zfp236 UTSW 18 82621423 missense probably damaging 1.00
R5264:Zfp236 UTSW 18 82630094 missense probably damaging 1.00
R5264:Zfp236 UTSW 18 82658073 missense probably damaging 0.99
R5339:Zfp236 UTSW 18 82624366 missense probably damaging 0.99
R5375:Zfp236 UTSW 18 82597688 missense possibly damaging 0.93
R5445:Zfp236 UTSW 18 82682156 missense probably benign 0.02
R5513:Zfp236 UTSW 18 82658022 missense probably damaging 0.97
R5527:Zfp236 UTSW 18 82658034 missense possibly damaging 0.51
R5628:Zfp236 UTSW 18 82657122 missense probably damaging 1.00
R5758:Zfp236 UTSW 18 82671709 missense probably damaging 1.00
R5890:Zfp236 UTSW 18 82640151 missense possibly damaging 0.87
R6137:Zfp236 UTSW 18 82671794 missense possibly damaging 0.89
R6193:Zfp236 UTSW 18 82604247 missense probably damaging 1.00
R6198:Zfp236 UTSW 18 82657153 missense probably damaging 1.00
R6239:Zfp236 UTSW 18 82657104 missense possibly damaging 0.53
R6705:Zfp236 UTSW 18 82633737 missense probably damaging 0.97
R6948:Zfp236 UTSW 18 82644062 missense possibly damaging 0.94
R6989:Zfp236 UTSW 18 82628363 missense probably damaging 1.00
R7002:Zfp236 UTSW 18 82691576 critical splice donor site probably null
R7113:Zfp236 UTSW 18 82620337 missense possibly damaging 0.82
R7261:Zfp236 UTSW 18 82609345 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TGCTTGGGTTCAGCCTCAAG -3'
(R):5'- GCAGAAGCCAGCTTTATCCAC -3'

Sequencing Primer
(F):5'- GCCTCAAGCTCTGCCTG -3'
(R):5'- GAAGCCAGCTTTATCCACAGTGG -3'
Posted On2015-04-30