Mutagenetix > Incidental Mutation

Incidental Mutation 'R4032:Mtor'

313526

Institutional Source

Beutler Lab

Gene Symbol

Mtor

Ensembl Gene

ENSMUSG00000028991

Gene Name

mechanistic target of rapamycin kinase

Synonyms

flat, 2610315D21Rik, RAPT1, RAFT1, mechanistic target of rapamycin (serine/threonine kinase), FKBP-rapamycin-associated protein FRAP, Frap1

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4032 (G1)

Quality Score

139

Status

Not validated

Chromosome

Chromosomal Location

148533068-148642140 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 148621209 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1869 (V1869A)

Ref Sequence

ENSEMBL: ENSMUSP00000099510 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000103221]

AlphaFold

Q9JLN9

Predicted Effect

probably benign
Transcript: ENSMUST00000103221
AA Change: V1869A

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000099510
Gene: ENSMUSG00000028991
AA Change: V1869A

Domain	Start	End	E-Value	Type
low complexity region	7	21	N/A	INTRINSIC
low complexity region	179	191	N/A	INTRINSIC
low complexity region	277	288	N/A	INTRINSIC
low complexity region	774	790	N/A	INTRINSIC
DUF3385	854	1024	1.51e-93	SMART
low complexity region	1279	1300	N/A	INTRINSIC
Pfam:FAT	1513	1908	2.3e-134	PFAM
Rapamycin_bind	2015	2114	7.94e-61	SMART
PI3Kc	2183	2484	8.84e-121	SMART
FATC	2517	2549	2.11e-15	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158456

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.8%
20x: 93.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of phosphatidylinositol kinase-related kinases. These kinases mediate cellular responses to stresses such as DNA damage and nutrient deprivation. This protein acts as the target for the cell-cycle arrest and immunosuppressive effects of the FKBP12-rapamycin complex. The ANGPTL7 gene is located in an intron of this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for targeted, gene trap and ENU-induced null alleles exhibit embryonic lethality by E12.5 with abnormal embryogenesis. Mice homozygous for the ENU mutation further exhibit abnormal brain development. [provided by MGI curators]

Allele List at MGI

All alleles(25) : Targeted(12) Gene trapped(12) Chemically induced(1)

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alkbh2	C	T	5: 114,262,287 (GRCm39)	E148K	probably damaging	Het
Arhgap17	G	T	7: 122,879,289 (GRCm39)		probably benign	Het
Atp13a4	T	A	16: 29,237,389 (GRCm39)	M846L	probably damaging	Het
Capn5	G	T	7: 97,778,453 (GRCm39)	Q389K	probably damaging	Het
Cdkl3	T	A	11: 51,902,118 (GRCm39)	I109N	probably damaging	Het
Cry2	T	C	2: 92,244,172 (GRCm39)	I334V	probably benign	Het
Cs	T	C	10: 128,196,913 (GRCm39)	L436P	probably damaging	Het
D17H6S53E	T	C	17: 35,346,355 (GRCm39)	S89P	probably benign	Het
Dync1h1	C	T	12: 110,584,483 (GRCm39)	Q629*	probably null	Het
H4c12	T	C	13: 21,934,588 (GRCm39)	I30V	possibly damaging	Het
Itpka	C	T	2: 119,573,082 (GRCm39)	P75S	probably benign	Het
Lyst	C	T	13: 13,791,250 (GRCm39)	H38Y	probably damaging	Het
Mansc4	T	C	6: 146,976,678 (GRCm39)	K313E	probably benign	Het
Megf6	T	A	4: 154,261,550 (GRCm39)	C58*	probably null	Het
Mybpc1	T	C	10: 88,365,426 (GRCm39)	D899G	probably benign	Het
Nek10	C	A	14: 14,853,877 (GRCm38)		probably null	Het
Nfkb1	T	C	3: 135,300,110 (GRCm39)	S657G	possibly damaging	Het
Or10d5j	T	C	9: 39,867,629 (GRCm39)	T213A	probably benign	Het
Or2a25	A	T	6: 42,888,559 (GRCm39)	Y34F	probably benign	Het
Or4m1	T	A	14: 50,557,767 (GRCm39)	D175V	possibly damaging	Het
Or4n5	G	T	14: 50,132,433 (GRCm39)	H275Q	probably benign	Het
Or51f23	A	G	7: 102,453,396 (GRCm39)	K237R	probably benign	Het
Pabir1	C	T	19: 24,454,106 (GRCm39)	M205I	probably benign	Het
Pde1b	A	G	15: 103,429,753 (GRCm39)	D82G	probably damaging	Het
Pdzrn4	C	T	15: 92,667,414 (GRCm39)	T522M	probably damaging	Het
Ptpro	C	A	6: 137,438,740 (GRCm39)	N373K	probably damaging	Het
Ptprs	T	C	17: 56,720,386 (GRCm39)	Y1478C	probably damaging	Het
Sdc2	A	T	15: 33,017,323 (GRCm39)	I46F	probably damaging	Het
Sergef	C	A	7: 46,092,726 (GRCm39)	E428*	probably null	Het
Stk36	A	G	1: 74,665,207 (GRCm39)	S651G	probably benign	Het
Ubr5	A	G	15: 38,025,081 (GRCm39)	V559A		Het
Ugt8a	C	A	3: 125,667,807 (GRCm39)	D345Y	probably damaging	Het
Usp44	A	G	10: 93,683,127 (GRCm39)		probably benign	Het
Vps13a	A	T	19: 16,594,263 (GRCm39)	L3156Q	probably damaging	Het
Zfp655	A	G	5: 145,180,858 (GRCm39)	T239A	possibly damaging	Het
Zfp87	T	C	13: 74,520,449 (GRCm39)	T210A	possibly damaging	Het

Other mutations in Mtor

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01123:Mtor	APN	4	148,537,494 (GRCm39)	missense	probably benign	0.06
IGL01447:Mtor	APN	4	148,615,214 (GRCm39)	missense	possibly damaging	0.62
IGL01551:Mtor	APN	4	148,556,494 (GRCm39)	missense	probably damaging	0.99
IGL01661:Mtor	APN	4	148,599,308 (GRCm39)	missense	possibly damaging	0.61
IGL01675:Mtor	APN	4	148,569,111 (GRCm39)	missense	probably benign	0.00
IGL01743:Mtor	APN	4	148,615,070 (GRCm39)	splice site	probably benign
IGL02015:Mtor	APN	4	148,624,570 (GRCm39)	nonsense	probably null
IGL02084:Mtor	APN	4	148,555,137 (GRCm39)	missense	probably damaging	0.98
IGL02095:Mtor	APN	4	148,628,998 (GRCm39)	missense	probably damaging	1.00
IGL02129:Mtor	APN	4	148,634,302 (GRCm39)	missense	possibly damaging	0.91
IGL02260:Mtor	APN	4	148,622,758 (GRCm39)	missense	probably damaging	1.00
IGL02329:Mtor	APN	4	148,619,396 (GRCm39)	missense	probably benign	0.16
IGL02440:Mtor	APN	4	148,576,104 (GRCm39)	missense	probably benign	0.04
IGL02440:Mtor	APN	4	148,630,886 (GRCm39)	missense	probably benign	0.24
IGL02449:Mtor	APN	4	148,618,378 (GRCm39)	missense	possibly damaging	0.65
IGL02479:Mtor	APN	4	148,555,041 (GRCm39)	missense	probably damaging	1.00
IGL02904:Mtor	APN	4	148,576,069 (GRCm39)	splice site	probably benign
IGL02904:Mtor	APN	4	148,536,851 (GRCm39)	missense	possibly damaging	0.55
IGL02931:Mtor	APN	4	148,549,421 (GRCm39)	missense	probably benign	0.22
IGL03048:Mtor	APN	4	148,630,847 (GRCm39)	splice site	probably benign
IGL03133:Mtor	APN	4	148,568,776 (GRCm39)	missense	probably benign	0.01
IGL03142:Mtor	APN	4	148,538,356 (GRCm39)	missense	probably benign	0.00
Brushes	UTSW	4	148,548,205 (GRCm39)	missense	probably benign	0.00
Dynamo	UTSW	4	148,547,367 (GRCm39)	missense	probably benign	0.00
engine	UTSW	4	148,641,312 (GRCm39)	splice site	probably null
Erg	UTSW	4	148,630,053 (GRCm39)	missense	probably damaging	1.00
Lindor	UTSW	4	148,539,103 (GRCm39)	missense	probably damaging	1.00
motor	UTSW	4	148,575,817 (GRCm39)	missense	possibly damaging	0.76
R4858_Mtor_211	UTSW	4	148,539,273 (GRCm39)	makesense	probably null
Vigor	UTSW	4	148,623,356 (GRCm39)	missense	probably damaging	1.00
Vim	UTSW	4	148,610,260 (GRCm39)	critical splice donor site	probably null
PIT4519001:Mtor	UTSW	4	148,608,957 (GRCm39)	missense	probably damaging	1.00
R0045:Mtor	UTSW	4	148,549,406 (GRCm39)	missense	probably benign	0.42
R0048:Mtor	UTSW	4	148,623,338 (GRCm39)	nonsense	probably null
R0048:Mtor	UTSW	4	148,623,338 (GRCm39)	nonsense	probably null
R0103:Mtor	UTSW	4	148,618,359 (GRCm39)	missense	probably benign	0.05
R0112:Mtor	UTSW	4	148,565,380 (GRCm39)	missense	probably damaging	1.00
R0137:Mtor	UTSW	4	148,555,081 (GRCm39)	missense	possibly damaging	0.78
R0184:Mtor	UTSW	4	148,549,428 (GRCm39)	missense	probably benign	0.05
R0208:Mtor	UTSW	4	148,549,432 (GRCm39)	missense	probably benign	0.43
R0329:Mtor	UTSW	4	148,568,837 (GRCm39)	missense	probably benign
R0330:Mtor	UTSW	4	148,568,837 (GRCm39)	missense	probably benign
R0365:Mtor	UTSW	4	148,570,507 (GRCm39)	missense	probably benign	0.01
R0537:Mtor	UTSW	4	148,622,817 (GRCm39)	missense	probably damaging	1.00
R0542:Mtor	UTSW	4	148,624,907 (GRCm39)	missense	probably benign	0.02
R0556:Mtor	UTSW	4	148,553,837 (GRCm39)	missense	possibly damaging	0.88
R0613:Mtor	UTSW	4	148,610,503 (GRCm39)	missense	possibly damaging	0.95
R0646:Mtor	UTSW	4	148,568,811 (GRCm39)	nonsense	probably null
R0710:Mtor	UTSW	4	148,548,848 (GRCm39)	missense	possibly damaging	0.73
R0791:Mtor	UTSW	4	148,547,367 (GRCm39)	missense	probably benign	0.00
R0792:Mtor	UTSW	4	148,547,367 (GRCm39)	missense	probably benign	0.00
R0866:Mtor	UTSW	4	148,570,513 (GRCm39)	missense	probably benign	0.04
R0973:Mtor	UTSW	4	148,634,645 (GRCm39)	missense	probably damaging	1.00
R1027:Mtor	UTSW	4	148,624,456 (GRCm39)	missense	probably benign	0.03
R1028:Mtor	UTSW	4	148,623,287 (GRCm39)	missense	possibly damaging	0.88
R1289:Mtor	UTSW	4	148,554,764 (GRCm39)	missense	probably benign	0.10
R1416:Mtor	UTSW	4	148,575,871 (GRCm39)	nonsense	probably null
R1465:Mtor	UTSW	4	148,610,450 (GRCm39)	splice site	probably benign
R1506:Mtor	UTSW	4	148,620,962 (GRCm39)	splice site	probably benign
R1624:Mtor	UTSW	4	148,632,133 (GRCm39)	missense	probably damaging	1.00
R1695:Mtor	UTSW	4	148,623,364 (GRCm39)	missense	probably benign	0.08
R1771:Mtor	UTSW	4	148,555,081 (GRCm39)	missense	possibly damaging	0.78
R1800:Mtor	UTSW	4	148,547,349 (GRCm39)	missense	probably benign	0.00
R1855:Mtor	UTSW	4	148,637,546 (GRCm39)	missense	probably benign	0.02
R1857:Mtor	UTSW	4	148,565,336 (GRCm39)	missense	probably damaging	1.00
R1867:Mtor	UTSW	4	148,539,089 (GRCm39)	missense	probably damaging	0.97
R1954:Mtor	UTSW	4	148,552,730 (GRCm39)	missense	probably damaging	1.00
R2054:Mtor	UTSW	4	148,550,482 (GRCm39)	missense	probably benign	0.00
R2054:Mtor	UTSW	4	148,547,309 (GRCm39)	missense	probably benign	0.05
R2099:Mtor	UTSW	4	148,634,649 (GRCm39)	nonsense	probably null
R2148:Mtor	UTSW	4	148,540,469 (GRCm39)	missense	possibly damaging	0.56
R2214:Mtor	UTSW	4	148,623,327 (GRCm39)	missense	probably benign	0.39
R2281:Mtor	UTSW	4	148,574,012 (GRCm39)	missense	probably benign	0.02
R2512:Mtor	UTSW	4	148,614,948 (GRCm39)	missense	possibly damaging	0.95
R2870:Mtor	UTSW	4	148,624,487 (GRCm39)	missense	probably benign	0.00
R2870:Mtor	UTSW	4	148,624,487 (GRCm39)	missense	probably benign	0.00
R2871:Mtor	UTSW	4	148,624,487 (GRCm39)	missense	probably benign	0.00
R2871:Mtor	UTSW	4	148,624,487 (GRCm39)	missense	probably benign	0.00
R2872:Mtor	UTSW	4	148,624,487 (GRCm39)	missense	probably benign	0.00
R2872:Mtor	UTSW	4	148,624,487 (GRCm39)	missense	probably benign	0.00
R2873:Mtor	UTSW	4	148,624,487 (GRCm39)	missense	probably benign	0.00
R4073:Mtor	UTSW	4	148,633,832 (GRCm39)	missense	probably damaging	0.99
R4273:Mtor	UTSW	4	148,634,609 (GRCm39)	missense	probably benign	0.21
R4611:Mtor	UTSW	4	148,570,576 (GRCm39)	missense	probably benign	0.03
R4858:Mtor	UTSW	4	148,539,273 (GRCm39)	makesense	probably null
R4942:Mtor	UTSW	4	148,556,599 (GRCm39)	missense	probably benign	0.03
R4967:Mtor	UTSW	4	148,575,817 (GRCm39)	missense	possibly damaging	0.76
R4995:Mtor	UTSW	4	148,610,209 (GRCm39)	missense	probably damaging	1.00
R5054:Mtor	UTSW	4	148,641,312 (GRCm39)	splice site	probably null
R5215:Mtor	UTSW	4	148,538,440 (GRCm39)	missense	probably benign
R5249:Mtor	UTSW	4	148,548,189 (GRCm39)	missense	probably damaging	1.00
R5289:Mtor	UTSW	4	148,550,549 (GRCm39)	missense	possibly damaging	0.88
R5365:Mtor	UTSW	4	148,634,587 (GRCm39)	missense	probably damaging	0.99
R5498:Mtor	UTSW	4	148,624,821 (GRCm39)	missense	possibly damaging	0.71
R5514:Mtor	UTSW	4	148,630,901 (GRCm39)	missense	probably damaging	1.00
R5540:Mtor	UTSW	4	148,539,165 (GRCm39)	missense	probably benign	0.01
R5600:Mtor	UTSW	4	148,575,927 (GRCm39)	missense	probably damaging	1.00
R5615:Mtor	UTSW	4	148,622,733 (GRCm39)	missense	possibly damaging	0.95
R5632:Mtor	UTSW	4	148,553,463 (GRCm39)	missense	possibly damaging	0.94
R5641:Mtor	UTSW	4	148,630,882 (GRCm39)	missense	probably damaging	0.98
R5834:Mtor	UTSW	4	148,620,993 (GRCm39)	missense	possibly damaging	0.95
R5984:Mtor	UTSW	4	148,623,284 (GRCm39)	missense	probably benign	0.02
R6056:Mtor	UTSW	4	148,621,892 (GRCm39)	missense	probably benign	0.00
R6225:Mtor	UTSW	4	148,605,794 (GRCm39)	missense	probably benign	0.04
R6262:Mtor	UTSW	4	148,610,552 (GRCm39)	missense	possibly damaging	0.46
R6335:Mtor	UTSW	4	148,550,384 (GRCm39)	missense	probably damaging	1.00
R6479:Mtor	UTSW	4	148,635,457 (GRCm39)	missense	probably benign	0.16
R6543:Mtor	UTSW	4	148,630,053 (GRCm39)	missense	probably damaging	1.00
R6711:Mtor	UTSW	4	148,536,824 (GRCm39)	missense	possibly damaging	0.49
R6715:Mtor	UTSW	4	148,623,004 (GRCm39)	missense	probably benign	0.00
R6744:Mtor	UTSW	4	148,543,112 (GRCm39)	missense	probably benign	0.01
R6748:Mtor	UTSW	4	148,634,641 (GRCm39)	missense	probably damaging	1.00
R6762:Mtor	UTSW	4	148,622,938 (GRCm39)	missense	possibly damaging	0.47
R6836:Mtor	UTSW	4	148,573,955 (GRCm39)	missense	possibly damaging	0.94
R6948:Mtor	UTSW	4	148,621,209 (GRCm39)	missense	probably benign	0.12
R6979:Mtor	UTSW	4	148,608,930 (GRCm39)	missense	possibly damaging	0.60
R6992:Mtor	UTSW	4	148,548,932 (GRCm39)	missense	probably benign
R7271:Mtor	UTSW	4	148,630,942 (GRCm39)	missense	possibly damaging	0.70
R7423:Mtor	UTSW	4	148,640,801 (GRCm39)	missense	possibly damaging	0.77
R7434:Mtor	UTSW	4	148,549,416 (GRCm39)	missense	probably benign	0.39
R7619:Mtor	UTSW	4	148,547,252 (GRCm39)	missense	probably damaging	0.98
R7634:Mtor	UTSW	4	148,536,807 (GRCm39)	missense	possibly damaging	0.53
R7697:Mtor	UTSW	4	148,624,765 (GRCm39)	nonsense	probably null
R7737:Mtor	UTSW	4	148,623,195 (GRCm39)	missense	possibly damaging	0.95
R7791:Mtor	UTSW	4	148,547,397 (GRCm39)	missense	probably benign	0.00
R7858:Mtor	UTSW	4	148,539,103 (GRCm39)	missense	probably damaging	1.00
R8035:Mtor	UTSW	4	148,630,856 (GRCm39)	missense	probably benign	0.29
R8076:Mtor	UTSW	4	148,610,260 (GRCm39)	critical splice donor site	probably null
R8078:Mtor	UTSW	4	148,552,744 (GRCm39)	missense	probably benign
R8928:Mtor	UTSW	4	148,623,356 (GRCm39)	missense	probably damaging	1.00
R9040:Mtor	UTSW	4	148,548,205 (GRCm39)	missense	probably benign	0.00
R9116:Mtor	UTSW	4	148,637,198 (GRCm39)	missense	probably benign
R9284:Mtor	UTSW	4	148,543,537 (GRCm39)	missense	probably benign	0.03
R9310:Mtor	UTSW	4	148,553,834 (GRCm39)	missense	probably benign	0.03
R9374:Mtor	UTSW	4	148,599,397 (GRCm39)	missense	probably damaging	1.00
R9417:Mtor	UTSW	4	148,622,776 (GRCm39)	nonsense	probably null
R9465:Mtor	UTSW	4	148,624,839 (GRCm39)	missense	possibly damaging	0.92
R9492:Mtor	UTSW	4	148,568,801 (GRCm39)	missense	probably damaging	1.00
R9499:Mtor	UTSW	4	148,599,397 (GRCm39)	missense	probably damaging	1.00
R9516:Mtor	UTSW	4	148,569,103 (GRCm39)	missense	probably benign	0.23
R9600:Mtor	UTSW	4	148,632,092 (GRCm39)	missense	possibly damaging	0.82
R9622:Mtor	UTSW	4	148,568,169 (GRCm39)	missense	probably damaging	0.99
X0025:Mtor	UTSW	4	148,615,171 (GRCm39)	missense	probably benign	0.09
Z1176:Mtor	UTSW	4	148,634,587 (GRCm39)	missense	possibly damaging	0.69
Z1176:Mtor	UTSW	4	148,634,582 (GRCm39)	missense	probably benign	0.08

Predicted Primers

PCR Primer
(F):5'- AGAACCAAGCCCGTGATGAG -3'
(R):5'- AATGTGCTCATTGCTGGGAGAAG -3'

Sequencing Primer
(F):5'- GAAGAAGAAGCTGCGTCATGCC -3'
(R):5'- AAGGAGCCTTGCTTCAGTCTGAC -3'

Posted On

2015-04-30