Incidental Mutation 'R0387:Myo5c'
ID31356
Institutional Source Beutler Lab
Gene Symbol Myo5c
Ensembl Gene ENSMUSG00000033590
Gene Namemyosin VC
Synonyms9130003O20Rik
MMRRC Submission 038593-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R0387 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location75232020-75305451 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 75285021 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150730 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036555] [ENSMUST00000216788]
Predicted Effect probably benign
Transcript: ENSMUST00000036555
SMART Domains Protein: ENSMUSP00000042229
Gene: ENSMUSG00000033590

DomainStartEndE-ValueType
MYSc 61 754 N/A SMART
IQ 755 777 1.11e-3 SMART
IQ 778 800 1.39e0 SMART
IQ 806 828 8.98e-4 SMART
IQ 829 851 4.19e-4 SMART
IQ 854 876 2.54e-3 SMART
coiled coil region 1160 1185 N/A INTRINSIC
coiled coil region 1207 1245 N/A INTRINSIC
DIL 1574 1679 5.54e-45 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215620
Predicted Effect probably benign
Transcript: ENSMUST00000216788
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.7%
  • 10x: 94.2%
  • 20x: 85.0%
Validation Efficiency 99% (77/78)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T G 7: 120,332,852 probably null Het
Abcc9 T A 6: 142,639,504 K825* probably null Het
Afp T C 5: 90,497,291 C189R probably damaging Het
Akap9 T C 5: 3,951,678 probably benign Het
Alpk3 A T 7: 81,104,227 T1652S possibly damaging Het
Atg4b C A 1: 93,786,556 Q354K probably benign Het
Atxn2 T C 5: 121,802,143 S388P possibly damaging Het
C2cd3 T A 7: 100,422,507 probably benign Het
Cacna2d2 C A 9: 107,513,881 T403K probably damaging Het
Cap2 C T 13: 46,560,516 H79Y probably damaging Het
Car10 G T 11: 93,583,021 probably null Het
Ccno T C 13: 112,989,867 L290P probably damaging Het
Cfap69 T C 5: 5,589,303 K624E probably damaging Het
Ctnna3 A G 10: 64,586,130 M568V probably benign Het
Cyp1b1 C A 17: 79,713,774 V180L probably benign Het
Cyp2u1 G T 3: 131,295,552 probably null Het
Dcp1a T C 14: 30,519,679 probably null Het
Dnm1 C T 2: 32,320,581 G1S possibly damaging Het
Dnmt1 A G 9: 20,918,213 L698P probably damaging Het
Dock10 C A 1: 80,540,276 C1327F probably damaging Het
Dph3b-ps A G 13: 106,546,855 noncoding transcript Het
Dpyd G A 3: 119,427,226 D949N probably benign Het
Dync2li1 A G 17: 84,655,340 K345E possibly damaging Het
Eml2 T A 7: 19,182,259 probably null Het
Exoc7 A G 11: 116,294,401 probably benign Het
Faah A T 4: 116,005,692 C113* probably null Het
Fcf1 T A 12: 84,973,002 D16E probably benign Het
Fcgbp T C 7: 28,091,454 probably benign Het
Ghr A G 15: 3,319,891 S602P probably benign Het
Gm10334 A G 6: 41,443,369 I141T possibly damaging Het
Gm5114 T C 7: 39,408,809 D462G probably benign Het
Gm8186 T A 17: 26,099,026 S66C probably damaging Het
Gorab C T 1: 163,396,834 V133M probably benign Het
Gria1 G A 11: 57,309,884 probably null Het
Grik1 T A 16: 88,034,350 probably benign Het
Gtf3c1 A G 7: 125,681,104 L378P probably damaging Het
Htr5b A T 1: 121,527,546 V215D probably damaging Het
Htra1 A G 7: 130,979,478 T319A probably damaging Het
Idh2 C T 7: 80,098,257 A232T probably damaging Het
Klrb1a A C 6: 128,609,734 H189Q possibly damaging Het
Lhfp A G 3: 53,043,328 T8A probably benign Het
Ly75 T A 2: 60,306,404 Y1493F probably benign Het
Mfsd5 T C 15: 102,281,096 I301T possibly damaging Het
Mlkl C T 8: 111,333,350 E135K probably damaging Het
Mrgprx2 A C 7: 48,499,160 M1R probably null Het
Mroh2a G C 1: 88,246,042 A871P probably damaging Het
Mtbp A G 15: 55,611,029 I280V possibly damaging Het
Nos3 A G 5: 24,367,585 K174R probably damaging Het
Oas2 A T 5: 120,745,672 probably benign Het
Olfr889 T A 9: 38,115,770 probably null Het
Pi4kb G C 3: 94,984,740 E256Q probably benign Het
Pik3c2a T A 7: 116,373,744 I739F probably damaging Het
Pla2r1 T A 2: 60,432,601 K1031N probably benign Het
Plk4 A T 3: 40,812,884 probably benign Het
Polq T C 16: 37,029,430 C349R probably damaging Het
Polq G T 16: 37,089,317 E2354D probably damaging Het
Prss22 A G 17: 23,993,929 L278P probably damaging Het
Ptprk G A 10: 28,354,629 V239I possibly damaging Het
Raph1 T G 1: 60,510,496 probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ripor3 C T 2: 167,983,772 W755* probably null Het
Rnd3 G T 2: 51,148,231 D77E probably damaging Het
Ryr1 T C 7: 29,083,367 probably benign Het
Serpinb1a C T 13: 32,848,738 V63I probably benign Het
Six1 T G 12: 73,046,041 Y129S probably damaging Het
Spata31d1a G A 13: 59,703,501 T271I probably damaging Het
Stab1 T C 14: 31,148,101 D1387G probably benign Het
Stra6 T A 9: 58,153,183 M625K probably benign Het
Syne1 T C 10: 5,351,029 S900G probably benign Het
Tdpoz4 A C 3: 93,796,700 K101N probably benign Het
Tigd2 T C 6: 59,211,158 Y337H probably benign Het
Tnxb A G 17: 34,683,574 I1134V probably benign Het
Tspyl5 A G 15: 33,686,935 I288T probably damaging Het
Ulk1 A G 5: 110,788,797 V61A possibly damaging Het
Xxylt1 A G 16: 30,957,376 Y381H probably benign Het
Zcchc9 T A 13: 91,800,947 M12L probably benign Het
Zfp106 T C 2: 120,528,472 probably null Het
Zfp74 T A 7: 29,934,754 T510S probably benign Het
Zfp808 A G 13: 62,169,478 T14A probably damaging Het
Other mutations in Myo5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Myo5c APN 9 75242880 splice site probably benign
IGL00848:Myo5c APN 9 75289181 missense probably benign
IGL01503:Myo5c APN 9 75263042 missense probably damaging 1.00
IGL01735:Myo5c APN 9 75301438 missense probably damaging 1.00
IGL01866:Myo5c APN 9 75269582 missense probably benign 0.00
IGL01956:Myo5c APN 9 75242876 splice site probably null
IGL02127:Myo5c APN 9 75300902 missense probably damaging 1.00
IGL02268:Myo5c APN 9 75246237 missense probably damaging 1.00
IGL02272:Myo5c APN 9 75266160 missense possibly damaging 0.73
IGL03052:Myo5c APN 9 75252516 splice site probably benign
IGL03179:Myo5c APN 9 75255866 missense possibly damaging 0.65
IGL03224:Myo5c APN 9 75278243 missense probably benign 0.01
PIT4142001:Myo5c UTSW 9 75283948 missense probably benign 0.00
R0126:Myo5c UTSW 9 75269525 missense probably benign 0.05
R0266:Myo5c UTSW 9 75284216 splice site probably benign
R0345:Myo5c UTSW 9 75297419 missense probably damaging 1.00
R0602:Myo5c UTSW 9 75266196 splice site probably null
R0675:Myo5c UTSW 9 75278289 missense probably benign
R0798:Myo5c UTSW 9 75257984 missense probably damaging 1.00
R0981:Myo5c UTSW 9 75271591 missense probably damaging 1.00
R1051:Myo5c UTSW 9 75290883 missense probably benign 0.00
R1072:Myo5c UTSW 9 75292208 missense probably damaging 1.00
R1144:Myo5c UTSW 9 75286448 missense probably damaging 1.00
R1454:Myo5c UTSW 9 75263066 missense possibly damaging 0.94
R1476:Myo5c UTSW 9 75275939 missense probably damaging 1.00
R1484:Myo5c UTSW 9 75300810 missense probably damaging 1.00
R1586:Myo5c UTSW 9 75267031 missense probably damaging 0.99
R1616:Myo5c UTSW 9 75296017 missense probably damaging 1.00
R1635:Myo5c UTSW 9 75277075 missense probably benign 0.09
R1800:Myo5c UTSW 9 75246164 missense probably damaging 1.00
R1838:Myo5c UTSW 9 75273553 missense probably damaging 1.00
R1840:Myo5c UTSW 9 75249735 missense probably damaging 1.00
R1885:Myo5c UTSW 9 75249761 missense probably damaging 1.00
R1897:Myo5c UTSW 9 75292241 missense probably benign 0.20
R1898:Myo5c UTSW 9 75297626 missense probably damaging 1.00
R2029:Myo5c UTSW 9 75289055 unclassified probably benign
R2063:Myo5c UTSW 9 75281868 missense probably benign 0.19
R2230:Myo5c UTSW 9 75273606 missense probably benign
R2519:Myo5c UTSW 9 75250436 missense probably damaging 1.00
R2520:Myo5c UTSW 9 75297649 nonsense probably null
R3034:Myo5c UTSW 9 75286577 missense probably benign 0.44
R3117:Myo5c UTSW 9 75266194 critical splice donor site probably null
R3432:Myo5c UTSW 9 75263001 missense probably damaging 1.00
R3751:Myo5c UTSW 9 75276002 missense probably damaging 1.00
R4132:Myo5c UTSW 9 75252568 missense probably benign 0.00
R4173:Myo5c UTSW 9 75246258 missense probably damaging 1.00
R4239:Myo5c UTSW 9 75283942 missense probably benign 0.01
R4429:Myo5c UTSW 9 75294001 missense probably damaging 1.00
R4574:Myo5c UTSW 9 75269611 missense probably benign 0.00
R4791:Myo5c UTSW 9 75290916 missense probably damaging 1.00
R4804:Myo5c UTSW 9 75245024 missense probably damaging 1.00
R4819:Myo5c UTSW 9 75292202 missense probably damaging 0.97
R4881:Myo5c UTSW 9 75284152 missense probably benign 0.00
R4900:Myo5c UTSW 9 75273543 missense probably damaging 1.00
R4964:Myo5c UTSW 9 75297509 missense possibly damaging 0.51
R4966:Myo5c UTSW 9 75269596 missense probably benign 0.03
R5057:Myo5c UTSW 9 75300873 missense probably damaging 1.00
R5347:Myo5c UTSW 9 75295205 missense probably null 1.00
R5399:Myo5c UTSW 9 75288074 missense possibly damaging 0.80
R5440:Myo5c UTSW 9 75258125 missense possibly damaging 0.91
R5569:Myo5c UTSW 9 75273510 missense probably damaging 1.00
R5600:Myo5c UTSW 9 75289154 missense probably benign 0.00
R5606:Myo5c UTSW 9 75275508 missense probably damaging 1.00
R5704:Myo5c UTSW 9 75272903 missense probably benign 0.00
R5798:Myo5c UTSW 9 75284198 missense probably benign 0.04
R5865:Myo5c UTSW 9 75297488 missense probably damaging 0.97
R6034:Myo5c UTSW 9 75255905 missense probably benign 0.05
R6034:Myo5c UTSW 9 75255905 missense probably benign 0.05
R6143:Myo5c UTSW 9 75249809 missense probably damaging 1.00
R6242:Myo5c UTSW 9 75273611 missense probably benign
R6253:Myo5c UTSW 9 75245037 missense probably damaging 1.00
R6264:Myo5c UTSW 9 75275554 missense probably benign
R6307:Myo5c UTSW 9 75272916 missense possibly damaging 0.73
R6358:Myo5c UTSW 9 75296012 missense possibly damaging 0.53
R6450:Myo5c UTSW 9 75286578 missense probably benign 0.26
R6598:Myo5c UTSW 9 75246234 missense probably damaging 1.00
R6618:Myo5c UTSW 9 75275637 critical splice donor site probably null
R6774:Myo5c UTSW 9 75289186 missense probably benign 0.05
R6865:Myo5c UTSW 9 75269596 missense probably benign 0.03
Z1088:Myo5c UTSW 9 75245059 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTAGGGACGACATACACAAGCC -3'
(R):5'- GCTGCATGAGCTAGTGAAGGGATATAC -3'

Sequencing Primer
(F):5'- CATACACAAGCCATGTAAAGGTG -3'
(R):5'- gagccaaatccccagcc -3'
Posted On2013-04-24