Incidental Mutation 'R4034:Csn1s2a'
ID313618
Institutional Source Beutler Lab
Gene Symbol Csn1s2a
Ensembl Gene ENSMUSG00000061937
Gene Namecasein alpha s2-like A
SynonymsCsn1s2a, Csng
MMRRC Submission 040962-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R4034 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location87774567-87788797 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87781887 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 115 (Q115R)
Ref Sequence ENSEMBL: ENSMUSP00000142901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076379] [ENSMUST00000196585] [ENSMUST00000196749] [ENSMUST00000200322]
Predicted Effect probably benign
Transcript: ENSMUST00000076379
AA Change: Q123R

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000075716
Gene: ENSMUSG00000061937
AA Change: Q123R

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
coiled coil region 58 86 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196585
AA Change: Q108R

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000143515
Gene: ENSMUSG00000061937
AA Change: Q108R

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
low complexity region 51 80 N/A INTRINSIC
low complexity region 87 100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196749
AA Change: Q122R

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000143715
Gene: ENSMUSG00000061937
AA Change: Q122R

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
coiled coil region 57 85 N/A INTRINSIC
low complexity region 101 114 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197019
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197544
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199200
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200200
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200210
Predicted Effect probably benign
Transcript: ENSMUST00000200322
AA Change: Q115R

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000142901
Gene: ENSMUSG00000061937
AA Change: Q115R

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
low complexity region 51 57 N/A INTRINSIC
low complexity region 72 87 N/A INTRINSIC
low complexity region 94 107 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200350
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 A T 11: 49,019,281 L775* probably null Het
Aarsd1 C T 11: 101,411,332 V301I probably damaging Het
Arap1 A T 7: 101,400,277 Y982F possibly damaging Het
Aspa T C 11: 73,308,771 K227E possibly damaging Het
Ccdc88c G A 12: 100,930,524 A1389V possibly damaging Het
Cngb1 C A 8: 95,264,450 C708F possibly damaging Het
Cwf19l2 A T 9: 3,456,803 H712L probably benign Het
Eml6 C A 11: 29,803,137 V925L probably benign Het
Fbll1 G A 11: 35,797,678 H253Y possibly damaging Het
Gm8251 A G 1: 44,058,866 V1024A probably benign Het
Hmgcr C G 13: 96,651,063 L852F probably damaging Het
Ltbp2 A T 12: 84,804,474 C836S probably damaging Het
Mroh9 A G 1: 163,080,553 probably null Het
Muc5ac G A 7: 141,799,844 probably null Het
Olfr1385 A G 11: 49,495,460 D309G possibly damaging Het
Pgm5 T A 19: 24,861,657 I45F probably damaging Het
Ppl T C 16: 5,106,857 T115A probably benign Het
Sgpp1 A G 12: 75,716,190 Y406H probably damaging Het
Srsf4 C T 4: 131,900,102 probably benign Het
St18 G A 1: 6,855,473 probably null Het
Tcerg1 T A 18: 42,519,533 N75K unknown Het
Tmco4 T C 4: 139,020,861 Y251H probably damaging Het
Usp42 C T 5: 143,715,439 S943N probably benign Het
Utp20 C T 10: 88,762,806 V103I probably benign Het
Vmn1r14 G A 6: 57,234,325 R252H possibly damaging Het
Wapl T C 14: 34,737,914 V1013A possibly damaging Het
Zfp37 G A 4: 62,191,696 T414I probably damaging Het
Zfp423 A G 8: 87,781,344 C666R probably damaging Het
Other mutations in Csn1s2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Csn1s2a APN 5 87784580 missense possibly damaging 0.83
IGL01829:Csn1s2a APN 5 87786710 missense unknown
R0137:Csn1s2a UTSW 5 87778967 missense possibly damaging 0.46
R1503:Csn1s2a UTSW 5 87775799 missense possibly damaging 0.66
R1799:Csn1s2a UTSW 5 87778193 missense probably damaging 0.97
R1870:Csn1s2a UTSW 5 87778199 missense probably benign 0.27
R2400:Csn1s2a UTSW 5 87780155 critical splice donor site probably null
R2897:Csn1s2a UTSW 5 87781821 missense unknown
R4360:Csn1s2a UTSW 5 87781841 missense possibly damaging 0.46
R4377:Csn1s2a UTSW 5 87775821 missense probably benign
R4834:Csn1s2a UTSW 5 87781778 missense probably benign 0.27
R4965:Csn1s2a UTSW 5 87781838 missense possibly damaging 0.83
R6807:Csn1s2a UTSW 5 87781872 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCTTTGTCAAACTGGCATAG -3'
(R):5'- TCACACATGAATGGTTTTGCGTG -3'

Sequencing Primer
(F):5'- AAACTTGACCTATGAAGAATAGTCAC -3'
(R):5'- CACATGAATGGTTTTGCGTGATTTAC -3'
Posted On2015-04-30