Incidental Mutation 'R0387:Car10'
ID31362
Institutional Source Beutler Lab
Gene Symbol Car10
Ensembl Gene ENSMUSG00000056158
Gene Namecarbonic anhydrase 10
SynonymsCA-RP X, 2700029L05Rik
MMRRC Submission 038593-MU
Accession Numbers

Genbank: NM_028296; MGI: 1919855

Is this an essential gene? Possibly essential (E-score: 0.630) question?
Stock #R0387 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location93098028-93601749 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 93583021 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042943] [ENSMUST00000107858] [ENSMUST00000107863]
Predicted Effect probably null
Transcript: ENSMUST00000042943
SMART Domains Protein: ENSMUSP00000035585
Gene: ENSMUSG00000056158

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Carb_anhydrase 33 301 2.25e-86 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107858
SMART Domains Protein: ENSMUSP00000103490
Gene: ENSMUSG00000056158

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Carb_anhydrase 33 277 2.21e-71 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107863
SMART Domains Protein: ENSMUSP00000103495
Gene: ENSMUSG00000056158

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Carb_anhydrase 33 301 2.25e-86 SMART
Meta Mutation Damage Score 0.624 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.7%
  • 10x: 94.2%
  • 20x: 85.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the carbonic anhydrase family of zinc metalloenzymes, which catalyze the reversible hydration of carbon dioxide in various biological processes. The protein encoded by this gene is an acatalytic member of the alpha-carbonic anhydrase subgroup, and it is thought to play a role in the central nervous system, especially in brain development. Multiple transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T G 7: 120,332,852 probably null Het
Abcc9 T A 6: 142,639,504 K825* probably null Het
Afp T C 5: 90,497,291 C189R probably damaging Het
Akap9 T C 5: 3,951,678 probably benign Het
Alpk3 A T 7: 81,104,227 T1652S possibly damaging Het
Atg4b C A 1: 93,786,556 Q354K probably benign Het
Atxn2 T C 5: 121,802,143 S388P possibly damaging Het
C2cd3 T A 7: 100,422,507 probably benign Het
Cacna2d2 C A 9: 107,513,881 T403K probably damaging Het
Cap2 C T 13: 46,560,516 H79Y probably damaging Het
Ccno T C 13: 112,989,867 L290P probably damaging Het
Cfap69 T C 5: 5,589,303 K624E probably damaging Het
Ctnna3 A G 10: 64,586,130 M568V probably benign Het
Cyp1b1 C A 17: 79,713,774 V180L probably benign Het
Cyp2u1 G T 3: 131,295,552 probably null Het
Dcp1a T C 14: 30,519,679 probably null Het
Dnm1 C T 2: 32,320,581 G1S possibly damaging Het
Dnmt1 A G 9: 20,918,213 L698P probably damaging Het
Dock10 C A 1: 80,540,276 C1327F probably damaging Het
Dph3b-ps A G 13: 106,546,855 noncoding transcript Het
Dpyd G A 3: 119,427,226 D949N probably benign Het
Dync2li1 A G 17: 84,655,340 K345E possibly damaging Het
Eml2 T A 7: 19,182,259 probably null Het
Exoc7 A G 11: 116,294,401 probably benign Het
Faah A T 4: 116,005,692 C113* probably null Het
Fcf1 T A 12: 84,973,002 D16E probably benign Het
Fcgbp T C 7: 28,091,454 probably benign Het
Ghr A G 15: 3,319,891 S602P probably benign Het
Gm10334 A G 6: 41,443,369 I141T possibly damaging Het
Gm5114 T C 7: 39,408,809 D462G probably benign Het
Gm8186 T A 17: 26,099,026 S66C probably damaging Het
Gorab C T 1: 163,396,834 V133M probably benign Het
Gria1 G A 11: 57,309,884 probably null Het
Grik1 T A 16: 88,034,350 probably benign Het
Gtf3c1 A G 7: 125,681,104 L378P probably damaging Het
Htr5b A T 1: 121,527,546 V215D probably damaging Het
Htra1 A G 7: 130,979,478 T319A probably damaging Het
Idh2 C T 7: 80,098,257 A232T probably damaging Het
Klrb1a A C 6: 128,609,734 H189Q possibly damaging Het
Lhfp A G 3: 53,043,328 T8A probably benign Het
Ly75 T A 2: 60,306,404 Y1493F probably benign Het
Mfsd5 T C 15: 102,281,096 I301T possibly damaging Het
Mlkl C T 8: 111,333,350 E135K probably damaging Het
Mrgprx2 A C 7: 48,499,160 M1R probably null Het
Mroh2a G C 1: 88,246,042 A871P probably damaging Het
Mtbp A G 15: 55,611,029 I280V possibly damaging Het
Myo5c A T 9: 75,285,021 probably benign Het
Nos3 A G 5: 24,367,585 K174R probably damaging Het
Oas2 A T 5: 120,745,672 probably benign Het
Olfr889 T A 9: 38,115,770 probably null Het
Pi4kb G C 3: 94,984,740 E256Q probably benign Het
Pik3c2a T A 7: 116,373,744 I739F probably damaging Het
Pla2r1 T A 2: 60,432,601 K1031N probably benign Het
Plk4 A T 3: 40,812,884 probably benign Het
Polq T C 16: 37,029,430 C349R probably damaging Het
Polq G T 16: 37,089,317 E2354D probably damaging Het
Prss22 A G 17: 23,993,929 L278P probably damaging Het
Ptprk G A 10: 28,354,629 V239I possibly damaging Het
Raph1 T G 1: 60,510,496 probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ripor3 C T 2: 167,983,772 W755* probably null Het
Rnd3 G T 2: 51,148,231 D77E probably damaging Het
Ryr1 T C 7: 29,083,367 probably benign Het
Serpinb1a C T 13: 32,848,738 V63I probably benign Het
Six1 T G 12: 73,046,041 Y129S probably damaging Het
Spata31d1a G A 13: 59,703,501 T271I probably damaging Het
Stab1 T C 14: 31,148,101 D1387G probably benign Het
Stra6 T A 9: 58,153,183 M625K probably benign Het
Syne1 T C 10: 5,351,029 S900G probably benign Het
Tdpoz4 A C 3: 93,796,700 K101N probably benign Het
Tigd2 T C 6: 59,211,158 Y337H probably benign Het
Tnxb A G 17: 34,683,574 I1134V probably benign Het
Tspyl5 A G 15: 33,686,935 I288T probably damaging Het
Ulk1 A G 5: 110,788,797 V61A possibly damaging Het
Xxylt1 A G 16: 30,957,376 Y381H probably benign Het
Zcchc9 T A 13: 91,800,947 M12L probably benign Het
Zfp106 T C 2: 120,528,472 probably null Het
Zfp74 T A 7: 29,934,754 T510S probably benign Het
Zfp808 A G 13: 62,169,478 T14A probably damaging Het
Other mutations in Car10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00670:Car10 APN 11 93304657 splice site probably benign
IGL01077:Car10 APN 11 93597143 missense possibly damaging 0.54
IGL01099:Car10 APN 11 93578690 missense possibly damaging 0.91
IGL02810:Car10 APN 11 93578696 missense probably damaging 1.00
IGL03037:Car10 APN 11 93100218 utr 5 prime probably benign
IGL03061:Car10 APN 11 93490525 missense probably damaging 0.98
IGL03105:Car10 APN 11 93100275 missense probably benign 0.07
IGL03347:Car10 APN 11 93100296 splice site probably benign
IGL02837:Car10 UTSW 11 93597251 missense probably damaging 0.96
R0076:Car10 UTSW 11 93490597 missense possibly damaging 0.93
R0076:Car10 UTSW 11 93490597 missense possibly damaging 0.93
R0511:Car10 UTSW 11 93490582 missense probably damaging 1.00
R1372:Car10 UTSW 11 93578699 missense probably benign 0.02
R4692:Car10 UTSW 11 93185158 critical splice donor site probably null
R4799:Car10 UTSW 11 93578666 missense possibly damaging 0.81
R5947:Car10 UTSW 11 93490613 missense probably damaging 1.00
R6010:Car10 UTSW 11 93599323 missense possibly damaging 0.52
R6013:Car10 UTSW 11 93185279 intron probably benign
R7268:Car10 UTSW 11 93599251 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- AGGACAATATGTTTGCCTGCCTCTC -3'
(R):5'- GGCGTGGATGACAAAGACACTCTG -3'

Sequencing Primer
(F):5'- CTCAAGATGAGGTGTCCTTACAG -3'
(R):5'- GACTTATGCTTAAAATGGGCTGC -3'
Posted On2013-04-24