Incidental Mutation 'R4034:Ccdc88c'
ID313638
Institutional Source Beutler Lab
Gene Symbol Ccdc88c
Ensembl Gene ENSMUSG00000021182
Gene Namecoiled-coil domain containing 88C
Synonyms0610010D24Rik, Daple
MMRRC Submission 040962-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4034 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location100911523-101029056 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 100930524 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 1389 (A1389V)
Ref Sequence ENSEMBL: ENSMUSP00000068629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068411] [ENSMUST00000085096]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068411
AA Change: A1389V

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000068629
Gene: ENSMUSG00000021182
AA Change: A1389V

DomainStartEndE-ValueType
Pfam:HOOK 7 586 5.9e-37 PFAM
low complexity region 601 613 N/A INTRINSIC
low complexity region 617 634 N/A INTRINSIC
Blast:BRLZ 668 719 3e-8 BLAST
low complexity region 724 744 N/A INTRINSIC
low complexity region 827 837 N/A INTRINSIC
low complexity region 847 866 N/A INTRINSIC
Blast:BRLZ 948 1007 6e-15 BLAST
coiled coil region 1035 1085 N/A INTRINSIC
low complexity region 1095 1110 N/A INTRINSIC
coiled coil region 1129 1252 N/A INTRINSIC
coiled coil region 1312 1384 N/A INTRINSIC
low complexity region 1430 1439 N/A INTRINSIC
low complexity region 1510 1524 N/A INTRINSIC
low complexity region 1562 1583 N/A INTRINSIC
low complexity region 1698 1709 N/A INTRINSIC
internal_repeat_1 1721 1778 6.97e-6 PROSPERO
low complexity region 1788 1808 N/A INTRINSIC
internal_repeat_1 1934 1989 6.97e-6 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000085096
AA Change: A1396V

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000082177
Gene: ENSMUSG00000021182
AA Change: A1396V

DomainStartEndE-ValueType
Pfam:HOOK 13 597 2.5e-41 PFAM
low complexity region 608 620 N/A INTRINSIC
low complexity region 624 641 N/A INTRINSIC
Blast:BRLZ 675 726 3e-8 BLAST
low complexity region 731 751 N/A INTRINSIC
low complexity region 834 844 N/A INTRINSIC
low complexity region 854 873 N/A INTRINSIC
Blast:BRLZ 955 1014 5e-15 BLAST
coiled coil region 1042 1092 N/A INTRINSIC
low complexity region 1102 1117 N/A INTRINSIC
coiled coil region 1136 1259 N/A INTRINSIC
coiled coil region 1319 1391 N/A INTRINSIC
low complexity region 1437 1446 N/A INTRINSIC
low complexity region 1517 1531 N/A INTRINSIC
low complexity region 1569 1590 N/A INTRINSIC
low complexity region 1705 1716 N/A INTRINSIC
internal_repeat_1 1728 1785 6.57e-6 PROSPERO
low complexity region 1795 1815 N/A INTRINSIC
internal_repeat_1 1941 1996 6.57e-6 PROSPERO
Meta Mutation Damage Score 0.052 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitously expressed coiled-coil domain-containing protein that interacts with the dishevelled protein and is a negative regulator of the Wnt signalling pathway. The protein encoded by this gene has a PDZ-domain binding motif in its C-terminus with which it interacts with the dishevelled protein. Dishevelled is a scaffold protein involved in the regulation of the Wnt signaling pathway. The Wnt signaling pathway plays an important role in embryonic development, tissue maintenance, and cancer progression. Mutations in this gene cause autosomal recessive, primary non-syndromic congenital hydrocephalus; a condition characterized by excessive accumulation of cerebrospinal fluid in the ventricles of the brain. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 A T 11: 49,019,281 L775* probably null Het
Aarsd1 C T 11: 101,411,332 V301I probably damaging Het
Arap1 A T 7: 101,400,277 Y982F possibly damaging Het
Aspa T C 11: 73,308,771 K227E possibly damaging Het
Cngb1 C A 8: 95,264,450 C708F possibly damaging Het
Csn1s2a A G 5: 87,781,887 Q115R probably benign Het
Cwf19l2 A T 9: 3,456,803 H712L probably benign Het
Eml6 C A 11: 29,803,137 V925L probably benign Het
Fbll1 G A 11: 35,797,678 H253Y possibly damaging Het
Gm8251 A G 1: 44,058,866 V1024A probably benign Het
Hmgcr C G 13: 96,651,063 L852F probably damaging Het
Ltbp2 A T 12: 84,804,474 C836S probably damaging Het
Mroh9 A G 1: 163,080,553 probably null Het
Muc5ac G A 7: 141,799,844 probably null Het
Olfr1385 A G 11: 49,495,460 D309G possibly damaging Het
Pgm5 T A 19: 24,861,657 I45F probably damaging Het
Ppl T C 16: 5,106,857 T115A probably benign Het
Sgpp1 A G 12: 75,716,190 Y406H probably damaging Het
Srsf4 C T 4: 131,900,102 probably benign Het
St18 G A 1: 6,855,473 probably null Het
Tcerg1 T A 18: 42,519,533 N75K unknown Het
Tmco4 T C 4: 139,020,861 Y251H probably damaging Het
Usp42 C T 5: 143,715,439 S943N probably benign Het
Utp20 C T 10: 88,762,806 V103I probably benign Het
Vmn1r14 G A 6: 57,234,325 R252H possibly damaging Het
Wapl T C 14: 34,737,914 V1013A possibly damaging Het
Zfp37 G A 4: 62,191,696 T414I probably damaging Het
Zfp423 A G 8: 87,781,344 C666R probably damaging Het
Other mutations in Ccdc88c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01112:Ccdc88c APN 12 100916803 missense probably benign 0.04
IGL02016:Ccdc88c APN 12 100941207 missense possibly damaging 0.63
IGL02031:Ccdc88c APN 12 100933311 missense probably damaging 0.98
IGL02133:Ccdc88c APN 12 100940090 missense probably damaging 1.00
IGL02427:Ccdc88c APN 12 100921592 missense probably damaging 1.00
IGL02494:Ccdc88c APN 12 100945475 missense probably benign
IGL02496:Ccdc88c APN 12 100953293 missense probably benign 0.05
IGL02549:Ccdc88c APN 12 100928932 missense probably benign 0.18
IGL02618:Ccdc88c APN 12 100913553 missense probably benign 0.28
IGL02626:Ccdc88c APN 12 100967800 unclassified probably benign
IGL03142:Ccdc88c APN 12 100947198 missense probably damaging 1.00
R0127:Ccdc88c UTSW 12 100935740 missense possibly damaging 0.88
R0533:Ccdc88c UTSW 12 100954282 missense probably damaging 1.00
R0545:Ccdc88c UTSW 12 100947188 missense probably damaging 1.00
R0866:Ccdc88c UTSW 12 100913192 missense probably benign 0.01
R1230:Ccdc88c UTSW 12 100948488 missense probably benign 0.00
R1434:Ccdc88c UTSW 12 100939166 splice site probably benign
R1614:Ccdc88c UTSW 12 100912984 missense probably benign 0.00
R1644:Ccdc88c UTSW 12 100913474 missense probably damaging 0.98
R1712:Ccdc88c UTSW 12 100939025 missense probably benign 0.14
R2107:Ccdc88c UTSW 12 100921549 missense probably benign
R3612:Ccdc88c UTSW 12 100939073 missense probably damaging 0.99
R3724:Ccdc88c UTSW 12 100930524 missense possibly damaging 0.80
R3737:Ccdc88c UTSW 12 100930524 missense possibly damaging 0.80
R3743:Ccdc88c UTSW 12 100948584 missense probably damaging 1.00
R3772:Ccdc88c UTSW 12 100966100 unclassified probably benign
R3776:Ccdc88c UTSW 12 100947179 missense probably damaging 0.97
R3917:Ccdc88c UTSW 12 100941107 critical splice donor site probably null
R4035:Ccdc88c UTSW 12 100930524 missense possibly damaging 0.80
R4110:Ccdc88c UTSW 12 100945073 missense probably damaging 1.00
R4113:Ccdc88c UTSW 12 100945073 missense probably damaging 1.00
R4270:Ccdc88c UTSW 12 100947219 missense probably damaging 1.00
R4271:Ccdc88c UTSW 12 100947219 missense probably damaging 1.00
R4520:Ccdc88c UTSW 12 100913332 missense possibly damaging 0.48
R4521:Ccdc88c UTSW 12 100913332 missense possibly damaging 0.48
R4522:Ccdc88c UTSW 12 100913332 missense possibly damaging 0.48
R4523:Ccdc88c UTSW 12 100913332 missense possibly damaging 0.48
R4524:Ccdc88c UTSW 12 100913332 missense possibly damaging 0.48
R4717:Ccdc88c UTSW 12 100916666 missense probably benign 0.00
R4821:Ccdc88c UTSW 12 100938079 missense probably benign 0.00
R4823:Ccdc88c UTSW 12 100930543 missense probably damaging 1.00
R5090:Ccdc88c UTSW 12 100954180 missense probably damaging 1.00
R5510:Ccdc88c UTSW 12 100945031 missense probably damaging 1.00
R5514:Ccdc88c UTSW 12 100913439 missense probably damaging 1.00
R5903:Ccdc88c UTSW 12 100930542 missense probably damaging 1.00
R5999:Ccdc88c UTSW 12 100968354 missense probably damaging 1.00
R6131:Ccdc88c UTSW 12 100941128 missense probably damaging 1.00
R6164:Ccdc88c UTSW 12 100953383 missense probably damaging 0.98
R6971:Ccdc88c UTSW 12 100954227 missense probably damaging 1.00
R6998:Ccdc88c UTSW 12 100916852 missense probably damaging 0.96
R7031:Ccdc88c UTSW 12 100945064 missense probably damaging 1.00
R7240:Ccdc88c UTSW 12 100944939 missense probably benign 0.17
R7366:Ccdc88c UTSW 12 100944950 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- ATTTGACAGCCTTCACAGGAC -3'
(R):5'- CTGACTTCTGATCTAGGTCGGG -3'

Sequencing Primer
(F):5'- ATGGGCAGCAGTTCTCAATC -3'
(R):5'- CGGGTTGGTAAGTACGCTCAC -3'
Posted On2015-04-30