Incidental Mutation 'R4035:Cep350'
ID313647
Institutional Source Beutler Lab
Gene Symbol Cep350
Ensembl Gene ENSMUSG00000033671
Gene Namecentrosomal protein 350
Synonyms6430546F08Rik, 4933409L06Rik
MMRRC Submission 041613-MU
Accession Numbers

Genbank: NM_001039184.1; Ensembl: ENSMUST00000138762, ENSMUST00000124495, ENSMUST00000078888

Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R4035 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location155844964-155973255 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 155959795 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 52 (T52A)
Ref Sequence ENSEMBL: ENSMUSP00000120085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124495] [ENSMUST00000138762]
Predicted Effect probably benign
Transcript: ENSMUST00000124495
Predicted Effect probably benign
Transcript: ENSMUST00000138762
AA Change: T52A

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000120085
Gene: ENSMUSG00000033671
AA Change: T52A

DomainStartEndE-ValueType
low complexity region 251 265 N/A INTRINSIC
low complexity region 376 394 N/A INTRINSIC
low complexity region 481 491 N/A INTRINSIC
coiled coil region 596 641 N/A INTRINSIC
low complexity region 659 669 N/A INTRINSIC
low complexity region 701 719 N/A INTRINSIC
low complexity region 754 763 N/A INTRINSIC
low complexity region 979 994 N/A INTRINSIC
low complexity region 1153 1175 N/A INTRINSIC
low complexity region 1250 1267 N/A INTRINSIC
coiled coil region 1363 1402 N/A INTRINSIC
low complexity region 1517 1531 N/A INTRINSIC
low complexity region 1536 1546 N/A INTRINSIC
low complexity region 1694 1714 N/A INTRINSIC
coiled coil region 1732 1794 N/A INTRINSIC
low complexity region 1800 1811 N/A INTRINSIC
low complexity region 1819 1835 N/A INTRINSIC
coiled coil region 1853 1893 N/A INTRINSIC
low complexity region 1980 1994 N/A INTRINSIC
coiled coil region 2042 2092 N/A INTRINSIC
low complexity region 2383 2394 N/A INTRINSIC
low complexity region 2409 2421 N/A INTRINSIC
low complexity region 2470 2482 N/A INTRINSIC
CAP_GLY 2486 2551 5.91e-31 SMART
coiled coil region 2700 2731 N/A INTRINSIC
Meta Mutation Damage Score 0.064 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a large protein with a CAP-Gly domain typically found in cytoskeleton-associated proteins. The encoded protein primarily localizes to the centrosome, a non-membraneous organelle that functions as the major microtubule-organizing center in animal cells. The encoded protein directly interacts with another large centrosomal protein and is required to anchor microtubules at the centrosome. It is also implicated in the regulation of a class of nuclear hormone receptors in the nucleus. Several alternatively spliced transcript variants have been found, but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI

 All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A G 6: 124,356,920 F34L probably benign Het
Abcb8 A G 5: 24,400,621 S168G probably benign Het
Ano5 A G 7: 51,566,485 probably benign Het
Api5 C T 2: 94,425,613 R243Q possibly damaging Het
Bhlhe41 A G 6: 145,863,028 S353P probably benign Het
Ccdc88c G A 12: 100,930,524 A1389V possibly damaging Het
Coro2b A G 9: 62,425,789 probably benign Het
Ctcf A T 8: 105,664,157 E132V possibly damaging Het
Cwf19l2 A T 9: 3,456,803 H712L probably benign Het
Cxcl2 A T 5: 90,904,413 Q87L possibly damaging Het
D3Ertd254e T G 3: 36,164,840 H337Q possibly damaging Het
Dopey1 T C 9: 86,494,433 V240A probably damaging Het
Etfdh C T 3: 79,613,711 V294I probably benign Het
Fnip2 C T 3: 79,479,501 V973I probably benign Het
Fyco1 T C 9: 123,801,283 T1286A probably benign Het
Gbp10 T A 5: 105,224,458 E145D possibly damaging Het
Gm13084 T A 4: 143,810,456 D435V probably benign Het
Gsdme A T 6: 50,229,448 N138K possibly damaging Het
Hcn4 A G 9: 58,843,889 D266G probably benign Het
Henmt1 T C 3: 108,958,685 V199A probably damaging Het
Hmcn2 A T 2: 31,336,612 K200* probably null Het
Hmgcr C G 13: 96,651,063 L852F probably damaging Het
Ifi203 T A 1: 173,929,474 probably benign Het
Isl2 A G 9: 55,542,470 S119G probably benign Het
Krba1 A G 6: 48,411,680 N538D probably damaging Het
Lcorl A T 5: 45,734,041 N323K possibly damaging Het
Mfsd2b A G 12: 4,870,578 S80P probably damaging Het
Ndst4 C T 3: 125,438,736 T318M probably damaging Het
Nlrp4f T C 13: 65,194,007 N608S probably benign Het
Nolc1 GCA GCACCA 19: 46,081,358 probably benign Het
Olfr212 A G 6: 116,516,629 N284S possibly damaging Het
Olfr878 G A 9: 37,918,641 probably benign Het
Osbpl2 G A 2: 180,161,560 R475H probably damaging Het
Ppfibp1 A G 6: 146,996,836 K97E probably damaging Het
Prpsap1 A T 11: 116,473,008 M263K probably benign Het
Prtg G T 9: 72,842,709 E132* probably null Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rttn T C 18: 88,995,653 V482A probably benign Het
Samsn1 A G 16: 75,909,185 M1T probably null Het
Scel A G 14: 103,530,004 N33S probably damaging Het
Sema4g A T 19: 45,001,414 Y644F probably damaging Het
Slc39a10 G A 1: 46,812,074 T752M probably damaging Het
Snx27 T C 3: 94,524,244 D281G probably damaging Het
Spesp1 T A 9: 62,273,036 I197L probably benign Het
Srsf4 C T 4: 131,900,102 probably benign Het
Tpgs1 A G 10: 79,669,365 probably null Het
Trpc2 G A 7: 102,084,504 S220N probably damaging Het
Ttk C A 9: 83,854,837 P450T possibly damaging Het
Ttn T G 2: 76,909,821 Q3458P probably benign Het
Ube2z A G 11: 96,061,067 F152L probably damaging Het
Utp20 C T 10: 88,762,806 V103I probably benign Het
Zfa-ps T A 10: 52,544,540 noncoding transcript Het
Other mutations in Cep350
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Cep350 APN 1 155940746 missense possibly damaging 0.68
IGL00821:Cep350 APN 1 155862204 missense probably benign
IGL00837:Cep350 APN 1 155953391 missense probably damaging 1.00
IGL00977:Cep350 APN 1 155932865 missense probably null 0.99
IGL01544:Cep350 APN 1 155953187 missense probably damaging 1.00
IGL01616:Cep350 APN 1 155953247 missense probably benign 0.00
IGL01695:Cep350 APN 1 155944158 missense probably damaging 1.00
IGL01902:Cep350 APN 1 155861985 missense probably damaging 1.00
IGL01977:Cep350 APN 1 155911968 missense probably benign 0.01
IGL02388:Cep350 APN 1 155953753 missense probably benign 0.28
IGL02475:Cep350 APN 1 155862595 missense probably damaging 1.00
IGL02528:Cep350 APN 1 155894615 missense probably damaging 1.00
IGL02598:Cep350 APN 1 155862967 missense probably benign 0.00
IGL02676:Cep350 APN 1 155862231 missense possibly damaging 0.82
IGL02728:Cep350 APN 1 155953222 missense probably benign 0.02
IGL02744:Cep350 APN 1 155931533 missense probably damaging 0.98
IGL02817:Cep350 APN 1 155928842 missense probably damaging 1.00
IGL02892:Cep350 APN 1 155868806 missense possibly damaging 0.51
IGL03156:Cep350 APN 1 155858042 missense probably damaging 1.00
IGL03166:Cep350 APN 1 155863600 missense possibly damaging 0.78
IGL03216:Cep350 APN 1 155860627 missense probably benign 0.06
IGL03268:Cep350 APN 1 155953549 missense probably benign 0.16
IGL03358:Cep350 APN 1 155928539 missense probably benign
NA:Cep350 UTSW 1 155958648 missense probably damaging 1.00
R0060:Cep350 UTSW 1 155928626 missense probably damaging 1.00
R0060:Cep350 UTSW 1 155928626 missense probably damaging 1.00
R0066:Cep350 UTSW 1 155911218 missense probably damaging 0.99
R0066:Cep350 UTSW 1 155911218 missense probably damaging 0.99
R0172:Cep350 UTSW 1 155953447 missense probably benign 0.00
R0365:Cep350 UTSW 1 155906571 missense probably benign 0.00
R0472:Cep350 UTSW 1 155914723 missense probably damaging 0.99
R0502:Cep350 UTSW 1 155900883 splice site probably null
R0538:Cep350 UTSW 1 155848620 missense possibly damaging 0.80
R0547:Cep350 UTSW 1 155901435 splice site probably null
R0565:Cep350 UTSW 1 155961195 splice site probably benign
R0607:Cep350 UTSW 1 155872048 missense probably damaging 1.00
R0645:Cep350 UTSW 1 155940712 splice site probably null
R0675:Cep350 UTSW 1 155959753 missense possibly damaging 0.63
R0828:Cep350 UTSW 1 155953246 missense probably benign 0.00
R0863:Cep350 UTSW 1 155862235 missense probably benign 0.00
R0969:Cep350 UTSW 1 155940826 missense possibly damaging 0.81
R1102:Cep350 UTSW 1 155931518 missense probably damaging 1.00
R1186:Cep350 UTSW 1 155875376 missense probably damaging 1.00
R1552:Cep350 UTSW 1 155910738 missense possibly damaging 0.92
R1560:Cep350 UTSW 1 155929079 missense possibly damaging 0.48
R1698:Cep350 UTSW 1 155953358 missense possibly damaging 0.62
R1729:Cep350 UTSW 1 155911981 missense probably benign 0.17
R1735:Cep350 UTSW 1 155953214 missense probably damaging 0.99
R1740:Cep350 UTSW 1 155928833 missense probably damaging 1.00
R1783:Cep350 UTSW 1 155928865 missense probably damaging 1.00
R1844:Cep350 UTSW 1 155848628 missense probably damaging 0.99
R1848:Cep350 UTSW 1 155953651 missense probably benign 0.28
R1988:Cep350 UTSW 1 155933104 missense possibly damaging 0.82
R2008:Cep350 UTSW 1 155914721 missense probably benign 0.16
R2241:Cep350 UTSW 1 155958556 splice site probably null
R2245:Cep350 UTSW 1 155879020 missense probably benign 0.10
R2402:Cep350 UTSW 1 155863136 missense probably benign
R2566:Cep350 UTSW 1 155959718 critical splice donor site probably null
R3160:Cep350 UTSW 1 155863164 missense probably benign 0.00
R3162:Cep350 UTSW 1 155863164 missense probably benign 0.00
R3769:Cep350 UTSW 1 155953204 missense probably damaging 1.00
R4158:Cep350 UTSW 1 155932875 missense probably damaging 1.00
R4160:Cep350 UTSW 1 155932875 missense probably damaging 1.00
R4213:Cep350 UTSW 1 155935961 missense probably damaging 1.00
R4483:Cep350 UTSW 1 155926468 missense probably benign 0.01
R4648:Cep350 UTSW 1 155902598 missense possibly damaging 0.85
R4694:Cep350 UTSW 1 155928586 missense probably damaging 1.00
R4836:Cep350 UTSW 1 155928833 missense probably damaging 1.00
R4839:Cep350 UTSW 1 155928494 missense probably benign 0.00
R4969:Cep350 UTSW 1 155860279 missense probably damaging 0.99
R5014:Cep350 UTSW 1 155928206 missense probably benign 0.00
R5027:Cep350 UTSW 1 155933354 missense probably benign 0.01
R5144:Cep350 UTSW 1 155911150 missense probably damaging 0.99
R5153:Cep350 UTSW 1 155935946 missense probably damaging 1.00
R5165:Cep350 UTSW 1 155928368 missense probably damaging 1.00
R5182:Cep350 UTSW 1 155858108 missense probably damaging 1.00
R5445:Cep350 UTSW 1 155894723 missense probably benign 0.01
R5738:Cep350 UTSW 1 155866078 missense probably damaging 1.00
R5809:Cep350 UTSW 1 155933341 missense probably damaging 0.98
R5855:Cep350 UTSW 1 155953762 missense probably benign 0.00
R6103:Cep350 UTSW 1 155924576 missense probably benign 0.05
R6139:Cep350 UTSW 1 155953279 missense probably benign 0.03
R6285:Cep350 UTSW 1 155953374 missense possibly damaging 0.48
R6430:Cep350 UTSW 1 155894673 missense probably damaging 1.00
R6446:Cep350 UTSW 1 155862154 missense probably benign
R6520:Cep350 UTSW 1 155933336 missense probably benign 0.02
R6712:Cep350 UTSW 1 155858106 missense possibly damaging 0.93
R6940:Cep350 UTSW 1 155928551 missense probably benign 0.01
R7020:Cep350 UTSW 1 155928331 missense probably damaging 1.00
R7056:Cep350 UTSW 1 155848627 missense probably damaging 1.00
R7141:Cep350 UTSW 1 155914748 missense probably damaging 1.00
R7215:Cep350 UTSW 1 155894707 missense possibly damaging 0.89
R7247:Cep350 UTSW 1 155910753 missense probably damaging 1.00
R7272:Cep350 UTSW 1 155953588 missense probably damaging 0.98
X0018:Cep350 UTSW 1 155953286 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- AAATGCAGGCGTGGCGTATG -3'
(R):5'- AGCATAGCCTTTCATAATGGTAGG -3'

Sequencing Primer
(F):5'- GTATGTGCATCTATCCCCACAAG -3'
(R):5'- GATTATGCGGTCTCTCTCC -3'
Posted On2015-04-30