Incidental Mutation 'R4035:Ctcf'
ID313672
Institutional Source Beutler Lab
Gene Symbol Ctcf
Ensembl Gene ENSMUSG00000005698
Gene NameCCCTC-binding factor
Synonyms
MMRRC Submission 041613-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4035 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location105636568-105682922 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 105664157 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 132 (E132V)
Ref Sequence ENSEMBL: ENSMUSP00000005841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005841]
Predicted Effect possibly damaging
Transcript: ENSMUST00000005841
AA Change: E132V

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000005841
Gene: ENSMUSG00000005698
AA Change: E132V

DomainStartEndE-ValueType
low complexity region 116 131 N/A INTRINSIC
low complexity region 202 211 N/A INTRINSIC
low complexity region 250 264 N/A INTRINSIC
ZnF_C2H2 266 288 1.22e-4 SMART
ZnF_C2H2 294 316 7.26e-3 SMART
ZnF_C2H2 322 345 6.88e-4 SMART
ZnF_C2H2 351 373 5.14e-3 SMART
ZnF_C2H2 379 401 2.09e-3 SMART
ZnF_C2H2 407 430 2.02e-1 SMART
ZnF_C2H2 437 460 9.44e-2 SMART
ZnF_C2H2 467 489 7.67e-2 SMART
ZnF_C2H2 495 517 3.34e-2 SMART
ZnF_C2H2 523 546 2.53e-2 SMART
ZnF_C2H2 555 575 1.23e1 SMART
low complexity region 592 657 N/A INTRINSIC
low complexity region 700 720 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116136
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128510
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129388
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132679
Meta Mutation Damage Score 0.152 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the BORIS + CTCF gene family and encodes a transcriptional regulator protein with 11 highly conserved zinc finger (ZF) domains. This nuclear protein is able to use different combinations of the ZF domains to bind different DNA target sequences and proteins. Depending upon the context of the site, the protein can bind a histone acetyltransferase (HAT)-containing complex and function as a transcriptional activator or bind a histone deacetylase (HDAC)-containing complex and function as a transcriptional repressor. If the protein is bound to a transcriptional insulator element, it can block communication between enhancers and upstream promoters, thereby regulating imprinted expression. Mutations in this gene have been associated with invasive breast cancers, prostate cancers, and Wilms' tumors. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a null allele die prior at implantation. Mice homozygous for a conditional allele activated in T cells exhibit a defect in the transition from immature single positive T cells to double positive T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A G 6: 124,356,920 F34L probably benign Het
Abcb8 A G 5: 24,400,621 S168G probably benign Het
Ano5 A G 7: 51,566,485 probably benign Het
Api5 C T 2: 94,425,613 R243Q possibly damaging Het
Bhlhe41 A G 6: 145,863,028 S353P probably benign Het
Ccdc88c G A 12: 100,930,524 A1389V possibly damaging Het
Cep350 T C 1: 155,959,795 T52A probably benign Het
Coro2b A G 9: 62,425,789 probably benign Het
Cwf19l2 A T 9: 3,456,803 H712L probably benign Het
Cxcl2 A T 5: 90,904,413 Q87L possibly damaging Het
D3Ertd254e T G 3: 36,164,840 H337Q possibly damaging Het
Dopey1 T C 9: 86,494,433 V240A probably damaging Het
Etfdh C T 3: 79,613,711 V294I probably benign Het
Fnip2 C T 3: 79,479,501 V973I probably benign Het
Fyco1 T C 9: 123,801,283 T1286A probably benign Het
Gbp10 T A 5: 105,224,458 E145D possibly damaging Het
Gm13084 T A 4: 143,810,456 D435V probably benign Het
Gsdme A T 6: 50,229,448 N138K possibly damaging Het
Hcn4 A G 9: 58,843,889 D266G probably benign Het
Henmt1 T C 3: 108,958,685 V199A probably damaging Het
Hmcn2 A T 2: 31,336,612 K200* probably null Het
Hmgcr C G 13: 96,651,063 L852F probably damaging Het
Ifi203 T A 1: 173,929,474 probably benign Het
Isl2 A G 9: 55,542,470 S119G probably benign Het
Krba1 A G 6: 48,411,680 N538D probably damaging Het
Lcorl A T 5: 45,734,041 N323K possibly damaging Het
Mfsd2b A G 12: 4,870,578 S80P probably damaging Het
Ndst4 C T 3: 125,438,736 T318M probably damaging Het
Nlrp4f T C 13: 65,194,007 N608S probably benign Het
Nolc1 GCA GCACCA 19: 46,081,358 probably benign Het
Olfr212 A G 6: 116,516,629 N284S possibly damaging Het
Olfr878 G A 9: 37,918,641 probably benign Het
Osbpl2 G A 2: 180,161,560 R475H probably damaging Het
Ppfibp1 A G 6: 146,996,836 K97E probably damaging Het
Prpsap1 A T 11: 116,473,008 M263K probably benign Het
Prtg G T 9: 72,842,709 E132* probably null Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rttn T C 18: 88,995,653 V482A probably benign Het
Samsn1 A G 16: 75,909,185 M1T probably null Het
Scel A G 14: 103,530,004 N33S probably damaging Het
Sema4g A T 19: 45,001,414 Y644F probably damaging Het
Slc39a10 G A 1: 46,812,074 T752M probably damaging Het
Snx27 T C 3: 94,524,244 D281G probably damaging Het
Spesp1 T A 9: 62,273,036 I197L probably benign Het
Srsf4 C T 4: 131,900,102 probably benign Het
Tpgs1 A G 10: 79,669,365 probably null Het
Trpc2 G A 7: 102,084,504 S220N probably damaging Het
Ttk C A 9: 83,854,837 P450T possibly damaging Het
Ttn T G 2: 76,909,821 Q3458P probably benign Het
Ube2z A G 11: 96,061,067 F152L probably damaging Het
Utp20 C T 10: 88,762,806 V103I probably benign Het
Zfa-ps T A 10: 52,544,540 noncoding transcript Het
Other mutations in Ctcf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Ctcf APN 8 105677336 missense unknown
IGL01068:Ctcf APN 8 105681485 unclassified probably benign
IGL01936:Ctcf APN 8 105670232 missense probably benign 0.21
IGL02010:Ctcf APN 8 105664965 missense probably damaging 1.00
IGL02545:Ctcf APN 8 105664381 missense probably benign 0.39
IGL02617:Ctcf APN 8 105677210 splice site probably benign
R0255:Ctcf UTSW 8 105664039 missense possibly damaging 0.76
R0348:Ctcf UTSW 8 105676157 nonsense probably null
R0497:Ctcf UTSW 8 105675040 splice site probably benign
R1238:Ctcf UTSW 8 105671277 splice site probably benign
R1903:Ctcf UTSW 8 105675988 splice site probably null
R2508:Ctcf UTSW 8 105671384 missense probably damaging 1.00
R4448:Ctcf UTSW 8 105680293 intron probably benign
R5106:Ctcf UTSW 8 105681498 unclassified probably benign
R6370:Ctcf UTSW 8 105664220 missense probably benign 0.05
R6378:Ctcf UTSW 8 105663791 missense possibly damaging 0.70
R6392:Ctcf UTSW 8 105664133 missense probably damaging 0.97
R6737:Ctcf UTSW 8 105664508 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCAACAGCAGTGTACAGATGG -3'
(R):5'- TGCCAGCTAGAGTCTTCCTG -3'

Sequencing Primer
(F):5'- CTTCTCCAGATGAAGACTGAAGTC -3'
(R):5'- CAGCTAGAGTCTTCCTGAGGAG -3'
Posted On2015-04-30