Incidental Mutation 'R4035:Olfr878'
ID313674
Institutional Source Beutler Lab
Gene Symbol Olfr878
Ensembl Gene ENSMUSG00000066747
Gene Nameolfactory receptor 878
SynonymsMOR163-1, GA_x6K02T2PVTD-31600511-31601440
MMRRC Submission 041613-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R4035 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location37917840-37922474 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 37918641 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086061] [ENSMUST00000212878] [ENSMUST00000214263] [ENSMUST00000216723]
Predicted Effect probably benign
Transcript: ENSMUST00000086061
SMART Domains Protein: ENSMUSP00000083228
Gene: ENSMUSG00000066747

DomainStartEndE-ValueType
Pfam:7tm_4 36 312 1.4e-46 PFAM
Pfam:7tm_1 46 294 5.6e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212878
Predicted Effect probably benign
Transcript: ENSMUST00000214263
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214813
Predicted Effect probably benign
Transcript: ENSMUST00000216723
Meta Mutation Damage Score 0.0932 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A G 6: 124,356,920 F34L probably benign Het
Abcb8 A G 5: 24,400,621 S168G probably benign Het
Ano5 A G 7: 51,566,485 probably benign Het
Api5 C T 2: 94,425,613 R243Q possibly damaging Het
Bhlhe41 A G 6: 145,863,028 S353P probably benign Het
Ccdc88c G A 12: 100,930,524 A1389V possibly damaging Het
Cep350 T C 1: 155,959,795 T52A probably benign Het
Coro2b A G 9: 62,425,789 probably benign Het
Ctcf A T 8: 105,664,157 E132V possibly damaging Het
Cwf19l2 A T 9: 3,456,803 H712L probably benign Het
Cxcl2 A T 5: 90,904,413 Q87L possibly damaging Het
D3Ertd254e T G 3: 36,164,840 H337Q possibly damaging Het
Dopey1 T C 9: 86,494,433 V240A probably damaging Het
Etfdh C T 3: 79,613,711 V294I probably benign Het
Fnip2 C T 3: 79,479,501 V973I probably benign Het
Fyco1 T C 9: 123,801,283 T1286A probably benign Het
Gbp10 T A 5: 105,224,458 E145D possibly damaging Het
Gm13084 T A 4: 143,810,456 D435V probably benign Het
Gsdme A T 6: 50,229,448 N138K possibly damaging Het
Hcn4 A G 9: 58,843,889 D266G probably benign Het
Henmt1 T C 3: 108,958,685 V199A probably damaging Het
Hmcn2 A T 2: 31,336,612 K200* probably null Het
Hmgcr C G 13: 96,651,063 L852F probably damaging Het
Ifi203 T A 1: 173,929,474 probably benign Het
Isl2 A G 9: 55,542,470 S119G probably benign Het
Krba1 A G 6: 48,411,680 N538D probably damaging Het
Lcorl A T 5: 45,734,041 N323K possibly damaging Het
Mfsd2b A G 12: 4,870,578 S80P probably damaging Het
Ndst4 C T 3: 125,438,736 T318M probably damaging Het
Nlrp4f T C 13: 65,194,007 N608S probably benign Het
Nolc1 GCA GCACCA 19: 46,081,358 probably benign Het
Olfr212 A G 6: 116,516,629 N284S possibly damaging Het
Osbpl2 G A 2: 180,161,560 R475H probably damaging Het
Ppfibp1 A G 6: 146,996,836 K97E probably damaging Het
Prpsap1 A T 11: 116,473,008 M263K probably benign Het
Prtg G T 9: 72,842,709 E132* probably null Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rttn T C 18: 88,995,653 V482A probably benign Het
Samsn1 A G 16: 75,909,185 M1T probably null Het
Scel A G 14: 103,530,004 N33S probably damaging Het
Sema4g A T 19: 45,001,414 Y644F probably damaging Het
Slc39a10 G A 1: 46,812,074 T752M probably damaging Het
Snx27 T C 3: 94,524,244 D281G probably damaging Het
Spesp1 T A 9: 62,273,036 I197L probably benign Het
Srsf4 C T 4: 131,900,102 probably benign Het
Tpgs1 A G 10: 79,669,365 probably null Het
Trpc2 G A 7: 102,084,504 S220N probably damaging Het
Ttk C A 9: 83,854,837 P450T possibly damaging Het
Ttn T G 2: 76,909,821 Q3458P probably benign Het
Ube2z A G 11: 96,061,067 F152L probably damaging Het
Utp20 C T 10: 88,762,806 V103I probably benign Het
Zfa-ps T A 10: 52,544,540 noncoding transcript Het
Other mutations in Olfr878
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Olfr878 APN 9 37919050 missense probably damaging 1.00
IGL01354:Olfr878 APN 9 37919544 missense possibly damaging 0.74
R0399:Olfr878 UTSW 9 37919553 missense possibly damaging 0.85
R1537:Olfr878 UTSW 9 37919274 missense probably benign 0.24
R3737:Olfr878 UTSW 9 37918641 splice site probably benign
R4675:Olfr878 UTSW 9 37919586 makesense probably null
R4700:Olfr878 UTSW 9 37918921 missense possibly damaging 0.77
R5719:Olfr878 UTSW 9 37919351 missense probably damaging 1.00
R5824:Olfr878 UTSW 9 37919565 missense probably benign 0.00
R5940:Olfr878 UTSW 9 37919437 missense probably damaging 1.00
R6116:Olfr878 UTSW 9 37918659 start codon destroyed probably null 0.94
R6705:Olfr878 UTSW 9 37918784 missense probably damaging 1.00
R7075:Olfr878 UTSW 9 37919074 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GGCAAGAACAGAATCCTTGTTATC -3'
(R):5'- ACCCAATTAAGGTGATCAGTCC -3'

Sequencing Primer
(F):5'- GTCCATGGGAAATGAGCTATGCTC -3'
(R):5'- GGTGATCAGTCCCAAATTGC -3'
Posted On2015-04-30