Incidental Mutation 'R4035:Utp20'
ID313685
Institutional Source Beutler Lab
Gene Symbol Utp20
Ensembl Gene ENSMUSG00000004356
Gene NameUTP20 small subunit processome component
Synonyms3830408P06Rik, DRIM, mDRIM
MMRRC Submission 041613-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.939) question?
Stock #R4035 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location88746607-88826804 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 88762806 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 103 (V103I)
Ref Sequence ENSEMBL: ENSMUSP00000151748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004470] [ENSMUST00000218967] [ENSMUST00000220188]
Predicted Effect probably benign
Transcript: ENSMUST00000004470
AA Change: V2031I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000004470
Gene: ENSMUSG00000004356
AA Change: V2031I

DomainStartEndE-ValueType
low complexity region 244 255 N/A INTRINSIC
low complexity region 442 454 N/A INTRINSIC
low complexity region 571 581 N/A INTRINSIC
low complexity region 695 704 N/A INTRINSIC
Pfam:DRIM 910 1534 2.6e-176 PFAM
low complexity region 1585 1598 N/A INTRINSIC
low complexity region 1705 1719 N/A INTRINSIC
low complexity region 2503 2513 N/A INTRINSIC
low complexity region 2589 2605 N/A INTRINSIC
low complexity region 2727 2737 N/A INTRINSIC
low complexity region 2746 2764 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218967
AA Change: V103I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000220188
AA Change: V103I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Meta Mutation Damage Score 0.106 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UTP20 is a component of the U3 small nucleolar RNA (snoRNA) (SNORD3A; MIM 180710) protein complex (U3 snoRNP) and is involved in 18S rRNA processing (Wang et al., 2007 [PubMed 17498821]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A G 6: 124,356,920 F34L probably benign Het
Abcb8 A G 5: 24,400,621 S168G probably benign Het
Ano5 A G 7: 51,566,485 probably benign Het
Api5 C T 2: 94,425,613 R243Q possibly damaging Het
Bhlhe41 A G 6: 145,863,028 S353P probably benign Het
Ccdc88c G A 12: 100,930,524 A1389V possibly damaging Het
Cep350 T C 1: 155,959,795 T52A probably benign Het
Coro2b A G 9: 62,425,789 probably benign Het
Ctcf A T 8: 105,664,157 E132V possibly damaging Het
Cwf19l2 A T 9: 3,456,803 H712L probably benign Het
Cxcl2 A T 5: 90,904,413 Q87L possibly damaging Het
D3Ertd254e T G 3: 36,164,840 H337Q possibly damaging Het
Dopey1 T C 9: 86,494,433 V240A probably damaging Het
Etfdh C T 3: 79,613,711 V294I probably benign Het
Fnip2 C T 3: 79,479,501 V973I probably benign Het
Fyco1 T C 9: 123,801,283 T1286A probably benign Het
Gbp10 T A 5: 105,224,458 E145D possibly damaging Het
Gm13084 T A 4: 143,810,456 D435V probably benign Het
Gsdme A T 6: 50,229,448 N138K possibly damaging Het
Hcn4 A G 9: 58,843,889 D266G probably benign Het
Henmt1 T C 3: 108,958,685 V199A probably damaging Het
Hmcn2 A T 2: 31,336,612 K200* probably null Het
Hmgcr C G 13: 96,651,063 L852F probably damaging Het
Ifi203 T A 1: 173,929,474 probably benign Het
Isl2 A G 9: 55,542,470 S119G probably benign Het
Krba1 A G 6: 48,411,680 N538D probably damaging Het
Lcorl A T 5: 45,734,041 N323K possibly damaging Het
Mfsd2b A G 12: 4,870,578 S80P probably damaging Het
Ndst4 C T 3: 125,438,736 T318M probably damaging Het
Nlrp4f T C 13: 65,194,007 N608S probably benign Het
Nolc1 GCA GCACCA 19: 46,081,358 probably benign Het
Olfr212 A G 6: 116,516,629 N284S possibly damaging Het
Olfr878 G A 9: 37,918,641 probably benign Het
Osbpl2 G A 2: 180,161,560 R475H probably damaging Het
Ppfibp1 A G 6: 146,996,836 K97E probably damaging Het
Prpsap1 A T 11: 116,473,008 M263K probably benign Het
Prtg G T 9: 72,842,709 E132* probably null Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rttn T C 18: 88,995,653 V482A probably benign Het
Samsn1 A G 16: 75,909,185 M1T probably null Het
Scel A G 14: 103,530,004 N33S probably damaging Het
Sema4g A T 19: 45,001,414 Y644F probably damaging Het
Slc39a10 G A 1: 46,812,074 T752M probably damaging Het
Snx27 T C 3: 94,524,244 D281G probably damaging Het
Spesp1 T A 9: 62,273,036 I197L probably benign Het
Srsf4 C T 4: 131,900,102 probably benign Het
Tpgs1 A G 10: 79,669,365 probably null Het
Trpc2 G A 7: 102,084,504 S220N probably damaging Het
Ttk C A 9: 83,854,837 P450T possibly damaging Het
Ttn T G 2: 76,909,821 Q3458P probably benign Het
Ube2z A G 11: 96,061,067 F152L probably damaging Het
Zfa-ps T A 10: 52,544,540 noncoding transcript Het
Other mutations in Utp20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Utp20 APN 10 88825444 missense possibly damaging 0.90
IGL00858:Utp20 APN 10 88809125 missense possibly damaging 0.69
IGL00858:Utp20 APN 10 88809138 missense probably benign
IGL00946:Utp20 APN 10 88748315 missense possibly damaging 0.82
IGL01061:Utp20 APN 10 88770704 missense probably benign 0.13
IGL01399:Utp20 APN 10 88758302 critical splice donor site probably null
IGL01548:Utp20 APN 10 88764781 missense probably damaging 1.00
IGL01587:Utp20 APN 10 88787535 missense probably damaging 0.98
IGL01789:Utp20 APN 10 88798279 critical splice donor site probably null
IGL01819:Utp20 APN 10 88792687 missense probably damaging 1.00
IGL02070:Utp20 APN 10 88821877 splice site probably benign
IGL02231:Utp20 APN 10 88791168 missense probably damaging 1.00
IGL02244:Utp20 APN 10 88815956 splice site probably benign
IGL02367:Utp20 APN 10 88771853 unclassified probably benign
IGL02553:Utp20 APN 10 88764795 missense probably damaging 0.99
IGL02748:Utp20 APN 10 88817295 missense probably benign 0.00
IGL02831:Utp20 APN 10 88815908 missense probably benign
IGL02986:Utp20 APN 10 88775285 missense probably damaging 1.00
IGL02997:Utp20 APN 10 88814034 missense probably benign
IGL03105:Utp20 APN 10 88791096 missense probably benign 0.10
IGL03251:Utp20 APN 10 88817326 critical splice acceptor site probably null
IGL03337:Utp20 APN 10 88754566 missense probably benign
IGL03348:Utp20 APN 10 88758317 missense probably benign 0.09
IGL03381:Utp20 APN 10 88822005 missense probably damaging 0.99
R0037:Utp20 UTSW 10 88798404 missense probably benign 0.05
R0107:Utp20 UTSW 10 88778391 missense probably benign 0.03
R0197:Utp20 UTSW 10 88777516 missense probably benign 0.22
R0219:Utp20 UTSW 10 88764675 missense probably damaging 1.00
R0315:Utp20 UTSW 10 88807421 missense probably damaging 1.00
R0328:Utp20 UTSW 10 88767107 missense possibly damaging 0.82
R0329:Utp20 UTSW 10 88817979 missense probably benign 0.00
R0330:Utp20 UTSW 10 88817979 missense probably benign 0.00
R0395:Utp20 UTSW 10 88818595 missense probably damaging 1.00
R0399:Utp20 UTSW 10 88820979 missense probably damaging 1.00
R0454:Utp20 UTSW 10 88822069 missense probably benign 0.00
R0456:Utp20 UTSW 10 88754573 missense possibly damaging 0.92
R0491:Utp20 UTSW 10 88760912 missense probably damaging 1.00
R0557:Utp20 UTSW 10 88748311 missense probably damaging 0.99
R0600:Utp20 UTSW 10 88767461 missense probably damaging 1.00
R0616:Utp20 UTSW 10 88770751 missense probably benign 0.14
R1076:Utp20 UTSW 10 88772459 missense probably benign 0.36
R1076:Utp20 UTSW 10 88772543 missense possibly damaging 0.86
R1330:Utp20 UTSW 10 88801189 missense probably damaging 0.96
R1440:Utp20 UTSW 10 88819339 missense probably benign 0.19
R1529:Utp20 UTSW 10 88753006 missense probably damaging 1.00
R1554:Utp20 UTSW 10 88764737 nonsense probably null
R1621:Utp20 UTSW 10 88762871 missense probably benign
R1641:Utp20 UTSW 10 88757972 missense possibly damaging 0.82
R1709:Utp20 UTSW 10 88749297 missense probably benign 0.29
R1734:Utp20 UTSW 10 88767461 missense probably damaging 1.00
R1755:Utp20 UTSW 10 88809769 missense probably benign 0.01
R1775:Utp20 UTSW 10 88770808 missense probably benign
R1866:Utp20 UTSW 10 88762770 nonsense probably null
R1867:Utp20 UTSW 10 88749443 missense probably benign
R1901:Utp20 UTSW 10 88753026 missense probably benign 0.02
R1902:Utp20 UTSW 10 88753026 missense probably benign 0.02
R1967:Utp20 UTSW 10 88816979 missense probably benign 0.03
R2060:Utp20 UTSW 10 88774795 missense probably damaging 0.98
R2102:Utp20 UTSW 10 88772917 missense probably damaging 0.99
R2110:Utp20 UTSW 10 88767451 critical splice donor site probably null
R2115:Utp20 UTSW 10 88786003 missense probably benign 0.02
R2128:Utp20 UTSW 10 88814055 missense probably damaging 0.99
R2129:Utp20 UTSW 10 88814055 missense probably damaging 0.99
R2180:Utp20 UTSW 10 88820939 missense probably damaging 0.98
R2280:Utp20 UTSW 10 88825503 splice site probably null
R2435:Utp20 UTSW 10 88820891 missense possibly damaging 0.89
R2914:Utp20 UTSW 10 88754475 critical splice donor site probably null
R3005:Utp20 UTSW 10 88777455 missense probably damaging 0.97
R3546:Utp20 UTSW 10 88782689 missense probably damaging 1.00
R3547:Utp20 UTSW 10 88782689 missense probably damaging 1.00
R3622:Utp20 UTSW 10 88757993 unclassified probably benign
R3737:Utp20 UTSW 10 88762806 missense probably benign 0.00
R3738:Utp20 UTSW 10 88762806 missense probably benign 0.00
R3841:Utp20 UTSW 10 88775203 unclassified probably benign
R4034:Utp20 UTSW 10 88762806 missense probably benign 0.00
R4157:Utp20 UTSW 10 88761867 missense probably benign
R4243:Utp20 UTSW 10 88807325 critical splice donor site probably null
R4295:Utp20 UTSW 10 88754519 missense possibly damaging 0.54
R4632:Utp20 UTSW 10 88778261 missense probably damaging 1.00
R4633:Utp20 UTSW 10 88752952 missense probably benign
R4684:Utp20 UTSW 10 88807445 nonsense probably null
R4731:Utp20 UTSW 10 88754520 missense possibly damaging 0.93
R4735:Utp20 UTSW 10 88816918 missense possibly damaging 0.91
R4772:Utp20 UTSW 10 88809935 missense probably benign 0.09
R4912:Utp20 UTSW 10 88771960 missense probably benign 0.01
R4974:Utp20 UTSW 10 88816949 missense probably benign 0.08
R4991:Utp20 UTSW 10 88746934 missense probably benign 0.09
R5004:Utp20 UTSW 10 88748273 missense probably damaging 0.98
R5037:Utp20 UTSW 10 88775330 missense probably benign 0.00
R5043:Utp20 UTSW 10 88798746 missense possibly damaging 0.70
R5108:Utp20 UTSW 10 88768873 missense probably benign 0.00
R5138:Utp20 UTSW 10 88747377 missense probably damaging 0.96
R5252:Utp20 UTSW 10 88750670 missense probably benign 0.01
R5394:Utp20 UTSW 10 88772915 nonsense probably null
R5470:Utp20 UTSW 10 88817896 missense probably benign 0.14
R5558:Utp20 UTSW 10 88751467 missense probably damaging 1.00
R5678:Utp20 UTSW 10 88809117 missense probably benign 0.00
R5822:Utp20 UTSW 10 88817285 missense probably benign 0.00
R5866:Utp20 UTSW 10 88772559 missense possibly damaging 0.82
R5924:Utp20 UTSW 10 88815922 missense probably benign 0.00
R6026:Utp20 UTSW 10 88768679 missense probably benign 0.04
R6363:Utp20 UTSW 10 88757080 missense probably damaging 1.00
R6434:Utp20 UTSW 10 88772533 nonsense probably null
R6477:Utp20 UTSW 10 88768918 missense probably benign 0.05
R6480:Utp20 UTSW 10 88755186 critical splice donor site probably null
R6989:Utp20 UTSW 10 88778240 missense probably benign 0.00
R7033:Utp20 UTSW 10 88754475 critical splice donor site probably null
R7192:Utp20 UTSW 10 88772459 missense probably benign 0.09
R7236:Utp20 UTSW 10 88749342 missense probably benign 0.28
R7260:Utp20 UTSW 10 88751472 missense probably benign 0.39
R7317:Utp20 UTSW 10 88762935 missense possibly damaging 0.83
R7318:Utp20 UTSW 10 88813949 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TTGGAAAGTTCTCAGCCCAAAC -3'
(R):5'- GGCTCTTCCTTAGAATGTCGC -3'

Sequencing Primer
(F):5'- TTCCCGAGCACTGGGATTACTAG -3'
(R):5'- AGAATGTCGCTCTCTGTTTGC -3'
Posted On2015-04-30