Incidental Mutation 'R4035:Ube2z'
ID313688
Institutional Source Beutler Lab
Gene Symbol Ube2z
Ensembl Gene ENSMUSG00000014349
Gene Nameubiquitin-conjugating enzyme E2Z
Synonyms
MMRRC Submission 041613-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.621) question?
Stock #R4035 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location96047432-96065388 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96061067 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 152 (F152L)
Ref Sequence ENSEMBL: ENSMUSP00000098097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100528]
Predicted Effect probably damaging
Transcript: ENSMUST00000100528
AA Change: F152L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098097
Gene: ENSMUSG00000014349
AA Change: F152L

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 49 84 N/A INTRINSIC
UBCc 104 255 2.26e-35 SMART
low complexity region 338 344 N/A INTRINSIC
Meta Mutation Damage Score 0.382 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme which ubiquitinates proteins which participate in signaling pathways and apoptosis. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A G 6: 124,356,920 F34L probably benign Het
Abcb8 A G 5: 24,400,621 S168G probably benign Het
Ano5 A G 7: 51,566,485 probably benign Het
Api5 C T 2: 94,425,613 R243Q possibly damaging Het
Bhlhe41 A G 6: 145,863,028 S353P probably benign Het
Ccdc88c G A 12: 100,930,524 A1389V possibly damaging Het
Cep350 T C 1: 155,959,795 T52A probably benign Het
Coro2b A G 9: 62,425,789 probably benign Het
Ctcf A T 8: 105,664,157 E132V possibly damaging Het
Cwf19l2 A T 9: 3,456,803 H712L probably benign Het
Cxcl2 A T 5: 90,904,413 Q87L possibly damaging Het
D3Ertd254e T G 3: 36,164,840 H337Q possibly damaging Het
Dopey1 T C 9: 86,494,433 V240A probably damaging Het
Etfdh C T 3: 79,613,711 V294I probably benign Het
Fnip2 C T 3: 79,479,501 V973I probably benign Het
Fyco1 T C 9: 123,801,283 T1286A probably benign Het
Gbp10 T A 5: 105,224,458 E145D possibly damaging Het
Gm13084 T A 4: 143,810,456 D435V probably benign Het
Gsdme A T 6: 50,229,448 N138K possibly damaging Het
Hcn4 A G 9: 58,843,889 D266G probably benign Het
Henmt1 T C 3: 108,958,685 V199A probably damaging Het
Hmcn2 A T 2: 31,336,612 K200* probably null Het
Hmgcr C G 13: 96,651,063 L852F probably damaging Het
Ifi203 T A 1: 173,929,474 probably benign Het
Isl2 A G 9: 55,542,470 S119G probably benign Het
Krba1 A G 6: 48,411,680 N538D probably damaging Het
Lcorl A T 5: 45,734,041 N323K possibly damaging Het
Mfsd2b A G 12: 4,870,578 S80P probably damaging Het
Ndst4 C T 3: 125,438,736 T318M probably damaging Het
Nlrp4f T C 13: 65,194,007 N608S probably benign Het
Nolc1 GCA GCACCA 19: 46,081,358 probably benign Het
Olfr212 A G 6: 116,516,629 N284S possibly damaging Het
Olfr878 G A 9: 37,918,641 probably benign Het
Osbpl2 G A 2: 180,161,560 R475H probably damaging Het
Ppfibp1 A G 6: 146,996,836 K97E probably damaging Het
Prpsap1 A T 11: 116,473,008 M263K probably benign Het
Prtg G T 9: 72,842,709 E132* probably null Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rttn T C 18: 88,995,653 V482A probably benign Het
Samsn1 A G 16: 75,909,185 M1T probably null Het
Scel A G 14: 103,530,004 N33S probably damaging Het
Sema4g A T 19: 45,001,414 Y644F probably damaging Het
Slc39a10 G A 1: 46,812,074 T752M probably damaging Het
Snx27 T C 3: 94,524,244 D281G probably damaging Het
Spesp1 T A 9: 62,273,036 I197L probably benign Het
Srsf4 C T 4: 131,900,102 probably benign Het
Tpgs1 A G 10: 79,669,365 probably null Het
Trpc2 G A 7: 102,084,504 S220N probably damaging Het
Ttk C A 9: 83,854,837 P450T possibly damaging Het
Ttn T G 2: 76,909,821 Q3458P probably benign Het
Utp20 C T 10: 88,762,806 V103I probably benign Het
Zfa-ps T A 10: 52,544,540 noncoding transcript Het
Other mutations in Ube2z
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01100:Ube2z APN 11 96063023 missense probably damaging 1.00
IGL01903:Ube2z APN 11 96065000 missense possibly damaging 0.67
ub40 UTSW 11 96050407 missense probably damaging 1.00
R0501:Ube2z UTSW 11 96050288 missense probably damaging 0.99
R5033:Ube2z UTSW 11 96050322 missense probably benign
R5067:Ube2z UTSW 11 96063009 missense probably benign 0.27
R5913:Ube2z UTSW 11 96061063 missense possibly damaging 0.56
R6284:Ube2z UTSW 11 96050407 missense probably damaging 1.00
X0019:Ube2z UTSW 11 96065111 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TTGCTAATACCAACTTGGCCTC -3'
(R):5'- CTATGTACATGAGTGAGCCCAG -3'

Sequencing Primer
(F):5'- GGCCTCTTACAAGTCTCTTCTTAC -3'
(R):5'- AGTGAGCCCAGGTGGTTC -3'
Posted On2015-04-30