Incidental Mutation 'R4036:Cntln'
ID313708
Institutional Source Beutler Lab
Gene Symbol Cntln
Ensembl Gene ENSMUSG00000038070
Gene Namecentlein, centrosomal protein
SynonymsB430108F07Rik, D530005L17Rik
MMRRC Submission 040963-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.350) question?
Stock #R4036 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location84884309-85131921 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85006488 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 610 (Y610C)
Ref Sequence ENSEMBL: ENSMUSP00000130491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047023] [ENSMUST00000169371]
Predicted Effect probably damaging
Transcript: ENSMUST00000047023
AA Change: Y610C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044138
Gene: ENSMUSG00000038070
AA Change: Y610C

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
internal_repeat_1 198 219 1.25e-5 PROSPERO
low complexity region 242 251 N/A INTRINSIC
internal_repeat_1 321 342 1.25e-5 PROSPERO
low complexity region 346 358 N/A INTRINSIC
coiled coil region 404 433 N/A INTRINSIC
low complexity region 434 446 N/A INTRINSIC
coiled coil region 458 481 N/A INTRINSIC
coiled coil region 516 584 N/A INTRINSIC
coiled coil region 606 648 N/A INTRINSIC
coiled coil region 674 780 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 973 1114 N/A INTRINSIC
low complexity region 1206 1217 N/A INTRINSIC
Blast:HisKA 1270 1326 1e-24 BLAST
low complexity region 1327 1348 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169371
AA Change: Y610C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130491
Gene: ENSMUSG00000038070
AA Change: Y610C

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
internal_repeat_1 198 219 1.24e-5 PROSPERO
low complexity region 242 251 N/A INTRINSIC
internal_repeat_1 321 342 1.24e-5 PROSPERO
low complexity region 346 358 N/A INTRINSIC
coiled coil region 404 433 N/A INTRINSIC
low complexity region 434 446 N/A INTRINSIC
coiled coil region 458 481 N/A INTRINSIC
coiled coil region 516 584 N/A INTRINSIC
coiled coil region 606 648 N/A INTRINSIC
coiled coil region 674 780 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 972 1113 N/A INTRINSIC
low complexity region 1205 1216 N/A INTRINSIC
Blast:HisKA 1269 1325 1e-24 BLAST
low complexity region 1326 1347 N/A INTRINSIC
Meta Mutation Damage Score 0.076 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544M13Rik T C 13: 114,607,669 noncoding transcript Het
Ahctf1 T C 1: 179,762,616 Q1364R possibly damaging Het
Anxa2 A G 9: 69,488,070 N265S probably damaging Het
Bcan A G 3: 87,996,116 probably null Het
Cyp39a1 C A 17: 43,676,940 A99E probably damaging Het
Drc1 A G 5: 30,347,182 I223V probably benign Het
Eef2kmt A T 16: 5,245,271 V335D probably damaging Het
Fanci T C 7: 79,444,822 L1167P probably damaging Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Gns C A 10: 121,371,190 T72N probably damaging Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Klk8 A G 7: 43,798,087 I9V probably null Het
Map4 A G 9: 110,032,215 T216A possibly damaging Het
Metrn T C 17: 25,795,010 T281A probably benign Het
Mid1-ps1 G A Y: 90,762,294 noncoding transcript Het
Ndc1 G A 4: 107,411,072 D602N probably benign Het
Nsd1 A G 13: 55,213,711 D164G possibly damaging Het
Olfr204 T A 16: 59,314,750 H219L probably benign Het
Pcdha8 T C 18: 36,992,861 M132T probably benign Het
Pomt2 A G 12: 87,111,522 probably null Het
Prrt3 AGGGGG AGGGG 6: 113,497,680 probably null Het
Rfx6 T A 10: 51,726,746 H786Q probably damaging Het
Scn4a A C 11: 106,322,057 L1374R possibly damaging Het
Slc16a9 C T 10: 70,274,956 T124M probably damaging Het
Slc46a2 A T 4: 59,913,818 F368L probably damaging Het
St18 T A 1: 6,827,786 I604K probably damaging Het
Ttn A G 2: 76,718,153 V31935A possibly damaging Het
Urb1 T C 16: 90,788,086 H549R probably benign Het
Vmn1r219 A G 13: 23,163,102 M154V probably benign Het
Zfp575 G A 7: 24,586,015 S67L possibly damaging Het
Other mutations in Cntln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Cntln APN 4 85006434 missense probably benign 0.25
IGL00743:Cntln APN 4 84979415 missense probably benign 0.06
IGL01014:Cntln APN 4 85049908 missense probably benign 0.25
IGL02217:Cntln APN 4 85100258 missense probably damaging 1.00
IGL02323:Cntln APN 4 85049789 missense probably benign 0.00
IGL02353:Cntln APN 4 85049850 missense probably damaging 0.98
IGL02360:Cntln APN 4 85049850 missense probably damaging 0.98
IGL02616:Cntln APN 4 85115452 critical splice donor site probably null
PIT4696001:Cntln UTSW 4 84974000 missense probably damaging 0.99
R0110:Cntln UTSW 4 85096757 missense probably damaging 1.00
R0324:Cntln UTSW 4 85092695 missense probably damaging 0.98
R0349:Cntln UTSW 4 84996485 missense probably damaging 1.00
R0519:Cntln UTSW 4 85005053 splice site probably benign
R0529:Cntln UTSW 4 85067825 missense probably damaging 1.00
R0582:Cntln UTSW 4 84884741 missense probably damaging 1.00
R1077:Cntln UTSW 4 84996479 missense probably damaging 1.00
R1345:Cntln UTSW 4 84973991 missense probably damaging 1.00
R1457:Cntln UTSW 4 85096839 missense probably benign 0.33
R1571:Cntln UTSW 4 84947586 nonsense probably null
R1622:Cntln UTSW 4 85063181 missense probably damaging 1.00
R1681:Cntln UTSW 4 84947635 missense probably damaging 1.00
R1777:Cntln UTSW 4 85130679 missense probably benign 0.23
R1808:Cntln UTSW 4 85096763 missense probably damaging 1.00
R1882:Cntln UTSW 4 85100835 missense probably damaging 1.00
R2056:Cntln UTSW 4 85049674 missense probably benign
R2965:Cntln UTSW 4 84974027 critical splice donor site probably null
R2968:Cntln UTSW 4 84957267 missense probably benign 0.27
R3104:Cntln UTSW 4 84957169 missense possibly damaging 0.95
R3106:Cntln UTSW 4 84957169 missense possibly damaging 0.95
R3121:Cntln UTSW 4 85005052 splice site probably benign
R3617:Cntln UTSW 4 85004977 nonsense probably null
R4009:Cntln UTSW 4 85063215 missense probably benign 0.45
R4548:Cntln UTSW 4 85096842 missense probably benign 0.27
R4592:Cntln UTSW 4 84971182 missense probably benign 0.00
R4666:Cntln UTSW 4 84971216 missense probably benign 0.13
R4826:Cntln UTSW 4 85005044 missense probably benign 0.03
R4836:Cntln UTSW 4 85049720 nonsense probably null
R4856:Cntln UTSW 4 84971229 missense probably benign 0.35
R4886:Cntln UTSW 4 84971229 missense probably benign 0.35
R4995:Cntln UTSW 4 85049883 missense probably benign 0.00
R5090:Cntln UTSW 4 84947593 missense probably damaging 0.98
R5202:Cntln UTSW 4 84971229 missense probably benign 0.35
R5905:Cntln UTSW 4 84971173 missense probably benign 0.03
R5953:Cntln UTSW 4 85049919 missense possibly damaging 0.92
R6028:Cntln UTSW 4 84971173 missense probably benign 0.03
R6298:Cntln UTSW 4 85096761 missense probably damaging 1.00
R6351:Cntln UTSW 4 85115354 missense probably damaging 0.99
R6371:Cntln UTSW 4 84884579 missense probably damaging 0.98
R6481:Cntln UTSW 4 85067510 missense probably benign 0.00
R6864:Cntln UTSW 4 85096792 missense probably damaging 0.99
R6874:Cntln UTSW 4 85067759 missense probably damaging 1.00
R6919:Cntln UTSW 4 85115368 missense probably benign 0.04
R7071:Cntln UTSW 4 85100385 missense probably damaging 1.00
R7113:Cntln UTSW 4 85049827 missense probably damaging 0.98
R7152:Cntln UTSW 4 84884700 missense possibly damaging 0.87
R7253:Cntln UTSW 4 85118473 missense probably damaging 1.00
R7289:Cntln UTSW 4 85046303 missense possibly damaging 0.80
R7440:Cntln UTSW 4 85063216 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GGACTTTAGCTTTTACATGCTTAGG -3'
(R):5'- CGGTTTCTGTTAGAGCTAGCAAATG -3'

Sequencing Primer
(F):5'- GAGATTTGGGCTCAATTCATAGATAG -3'
(R):5'- GTGCTTCTCTAATAGACTTTG -3'
Posted On2015-04-30