Incidental Mutation 'R4037:Ruvbl1'
ID313755
Institutional Source Beutler Lab
Gene Symbol Ruvbl1
Ensembl Gene ENSMUSG00000030079
Gene NameRuvB-like protein 1
SynonymsTip49a, 2510009G06Rik, Pontin52
MMRRC Submission 040964-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R4037 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location88465409-88497572 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 88473135 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 96 (M96K)
Ref Sequence ENSEMBL: ENSMUSP00000032165 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032165] [ENSMUST00000129035]
Predicted Effect probably damaging
Transcript: ENSMUST00000032165
AA Change: M96K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032165
Gene: ENSMUSG00000030079
AA Change: M96K

DomainStartEndE-ValueType
AAA 62 365 1.51e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000129035
AA Change: M36K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117925
Gene: ENSMUSG00000030079
AA Change: M36K

DomainStartEndE-ValueType
Pfam:AAA_19 1 77 1.3e-7 PFAM
Pfam:TIP49 1 134 2.7e-60 PFAM
Pfam:RuvB_N 2 52 5.5e-7 PFAM
Pfam:AAA 6 80 1.5e-10 PFAM
Meta Mutation Damage Score 0.426 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 93% (37/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has both DNA-dependent ATPase and DNA helicase activities and belongs to the ATPases associated with diverse cellular activities (AAA+) protein family. The encoded protein associates with several multisubunit transcriptional complexes and with protein complexes involved in both ATP-dependent remodeling and histone modification. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a null allele show impaired proliferation of the pluripotent inner mass cells and embryonic lethality before implantation. Conditional ablation of this gene in hematopoietic tissues leads to bone marrow failure involving apoptotic loss of hematopoietic stem cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 A G 15: 64,725,470 F881L probably benign Het
Capn6 A G X: 143,807,863 W291R probably damaging Het
Cdc27 T C 11: 104,507,207 I776V probably damaging Het
Cpne5 C T 17: 29,159,113 R564H unknown Het
Crnkl1 T A 2: 145,932,327 D72V possibly damaging Het
Dcc A G 18: 72,350,397 L17P possibly damaging Het
Dhcr24 T C 4: 106,573,878 F255L probably benign Het
Eef2kmt A T 16: 5,245,271 V335D probably damaging Het
Efcc1 C T 6: 87,731,508 Q206* probably null Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Gpr137c C A 14: 45,220,230 L80I probably damaging Het
Hcls1 A G 16: 36,956,625 T226A possibly damaging Het
Hmcn1 T A 1: 150,772,502 T678S probably benign Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Hspb8 A G 5: 116,409,344 V193A probably benign Het
Man1c1 C T 4: 134,593,339 D217N probably damaging Het
Metrn T C 17: 25,795,010 T281A probably benign Het
Mmachc T A 4: 116,706,018 T47S probably damaging Het
Ncoa6 G A 2: 155,407,370 S1338L probably damaging Het
Ogfrl1 T C 1: 23,378,964 probably benign Het
Olfr1218 A G 2: 89,054,688 V246A probably damaging Het
Olfr1246 C T 2: 89,591,035 V27I probably benign Het
Pax4 A G 6: 28,443,883 I241T probably benign Het
Prkaa2 T C 4: 105,051,247 N144D probably damaging Het
Rims1 T C 1: 22,475,712 S537G probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Sdk2 T C 11: 113,795,055 I1880V probably damaging Het
Sis T C 3: 72,928,602 N885D probably benign Het
Skint5 G T 4: 113,885,814 T352K unknown Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc36a2 T C 11: 55,164,275 D318G probably benign Het
Slc38a4 G A 15: 96,997,042 A531V probably benign Het
Stat3 C T 11: 100,893,125 G658R probably damaging Het
Tnfrsf11a A G 1: 105,827,739 probably null Het
Tnk2 G T 16: 32,670,796 A298S probably damaging Het
Vmn1r218 T C 13: 23,136,801 V26A possibly damaging Het
Wipf3 G A 6: 54,481,828 G56D probably damaging Het
Other mutations in Ruvbl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Ruvbl1 APN 6 88484403 unclassified probably benign
IGL00473:Ruvbl1 APN 6 88491568 missense probably damaging 1.00
IGL01768:Ruvbl1 APN 6 88497271 missense probably benign
IGL03354:Ruvbl1 APN 6 88479215 nonsense probably null
R0106:Ruvbl1 UTSW 6 88473200 missense probably damaging 1.00
R0106:Ruvbl1 UTSW 6 88473200 missense probably damaging 1.00
R0145:Ruvbl1 UTSW 6 88484459 missense possibly damaging 0.90
R0676:Ruvbl1 UTSW 6 88473200 missense probably damaging 1.00
R1448:Ruvbl1 UTSW 6 88467569 missense probably benign 0.05
R1561:Ruvbl1 UTSW 6 88479154 missense probably damaging 1.00
R1574:Ruvbl1 UTSW 6 88479154 missense probably damaging 1.00
R1623:Ruvbl1 UTSW 6 88485770 missense probably damaging 1.00
R2113:Ruvbl1 UTSW 6 88483021 missense probably damaging 0.99
R2372:Ruvbl1 UTSW 6 88485797 missense possibly damaging 0.53
R2397:Ruvbl1 UTSW 6 88465552 missense possibly damaging 0.71
R2894:Ruvbl1 UTSW 6 88479132 missense possibly damaging 0.87
R4604:Ruvbl1 UTSW 6 88485905 missense probably benign
R4684:Ruvbl1 UTSW 6 88491599 missense probably benign 0.00
R4714:Ruvbl1 UTSW 6 88484430 missense possibly damaging 0.61
R4835:Ruvbl1 UTSW 6 88497229 missense possibly damaging 0.69
R4939:Ruvbl1 UTSW 6 88483039 unclassified probably null
R5114:Ruvbl1 UTSW 6 88497290 missense probably benign 0.41
R5126:Ruvbl1 UTSW 6 88485901 missense probably benign 0.13
R5296:Ruvbl1 UTSW 6 88485908 missense probably damaging 0.99
R5507:Ruvbl1 UTSW 6 88467600 missense probably benign 0.00
R5559:Ruvbl1 UTSW 6 88473096 missense possibly damaging 0.90
R5819:Ruvbl1 UTSW 6 88483115 splice site probably null
R6048:Ruvbl1 UTSW 6 88482991 missense possibly damaging 0.90
R6155:Ruvbl1 UTSW 6 88479125 critical splice acceptor site probably null
R6564:Ruvbl1 UTSW 6 88479226 missense possibly damaging 0.93
R6704:Ruvbl1 UTSW 6 88479205 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CATGGAATGTGCCTGTGAAG -3'
(R):5'- TTGACAACCAAGAAGCTGCAAG -3'

Sequencing Primer
(F):5'- AATGTGCCTGTGAAGGTAGAG -3'
(R):5'- AAGCTGCAAGGCACCTG -3'
Posted On2015-04-30