Incidental Mutation 'R4037:Cdc27'
ID313763
Institutional Source Beutler Lab
Gene Symbol Cdc27
Ensembl Gene ENSMUSG00000020687
Gene Namecell division cycle 27
SynonymsAPC3
MMRRC Submission 040964-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R4037 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location104502745-104550620 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104507207 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 776 (I776V)
Ref Sequence ENSEMBL: ENSMUSP00000091452 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093923] [ENSMUST00000106962]
Predicted Effect probably damaging
Transcript: ENSMUST00000093923
AA Change: I776V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000091452
Gene: ENSMUSG00000020687
AA Change: I776V

DomainStartEndE-ValueType
Pfam:Apc3 17 95 2.2e-23 PFAM
TPR 115 148 4.45e-2 SMART
low complexity region 349 362 N/A INTRINSIC
TPR 500 533 1.33e1 SMART
TPR 568 601 2.91e-6 SMART
TPR 602 635 7.06e-5 SMART
TPR 636 669 3.96e-8 SMART
TPR 670 703 7.45e-4 SMART
TPR 704 737 6.92e1 SMART
TPR 738 771 1.17e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106962
AA Change: I782V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102575
Gene: ENSMUSG00000020687
AA Change: I782V

DomainStartEndE-ValueType
Pfam:ANAPC3 17 94 7.7e-25 PFAM
TPR 115 148 4.45e-2 SMART
low complexity region 355 368 N/A INTRINSIC
TPR 506 539 1.33e1 SMART
TPR 574 607 2.91e-6 SMART
TPR 608 641 7.06e-5 SMART
TPR 642 675 3.96e-8 SMART
TPR 676 709 7.45e-4 SMART
TPR 710 743 6.92e1 SMART
TPR 744 777 1.17e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127506
Meta Mutation Damage Score 0.3 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 93% (37/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares strong similarity with Saccharomyces cerevisiae protein Cdc27, and the gene product of Schizosaccharomyces pombe nuc 2. This protein is a component of the anaphase-promoting complex (APC), which is composed of eight protein subunits and is highly conserved in eukaryotic cells. This complex catalyzes the formation of cyclin B-ubiquitin conjugate, which is responsible for the ubiquitin-mediated proteolysis of B-type cyclins. The protein encoded by this gene and three other members of the APC complex contain tetratricopeptide (TPR) repeats, which are important for protein-protein interactions. This protein was shown to interact with mitotic checkpoint proteins including Mad2, p55CDC and BUBR1, and it may thus be involved in controlling the timing of mitosis. Alternative splicing of this gene results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 2, 22 and Y. [provided by RefSeq, May 2014]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 A G 15: 64,725,470 F881L probably benign Het
Capn6 A G X: 143,807,863 W291R probably damaging Het
Cpne5 C T 17: 29,159,113 R564H unknown Het
Crnkl1 T A 2: 145,932,327 D72V possibly damaging Het
Dcc A G 18: 72,350,397 L17P possibly damaging Het
Dhcr24 T C 4: 106,573,878 F255L probably benign Het
Eef2kmt A T 16: 5,245,271 V335D probably damaging Het
Efcc1 C T 6: 87,731,508 Q206* probably null Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Gpr137c C A 14: 45,220,230 L80I probably damaging Het
Hcls1 A G 16: 36,956,625 T226A possibly damaging Het
Hmcn1 T A 1: 150,772,502 T678S probably benign Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Hspb8 A G 5: 116,409,344 V193A probably benign Het
Man1c1 C T 4: 134,593,339 D217N probably damaging Het
Metrn T C 17: 25,795,010 T281A probably benign Het
Mmachc T A 4: 116,706,018 T47S probably damaging Het
Ncoa6 G A 2: 155,407,370 S1338L probably damaging Het
Ogfrl1 T C 1: 23,378,964 probably benign Het
Olfr1218 A G 2: 89,054,688 V246A probably damaging Het
Olfr1246 C T 2: 89,591,035 V27I probably benign Het
Pax4 A G 6: 28,443,883 I241T probably benign Het
Prkaa2 T C 4: 105,051,247 N144D probably damaging Het
Rims1 T C 1: 22,475,712 S537G probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Ruvbl1 T A 6: 88,473,135 M96K probably damaging Het
Sdk2 T C 11: 113,795,055 I1880V probably damaging Het
Sis T C 3: 72,928,602 N885D probably benign Het
Skint5 G T 4: 113,885,814 T352K unknown Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc36a2 T C 11: 55,164,275 D318G probably benign Het
Slc38a4 G A 15: 96,997,042 A531V probably benign Het
Stat3 C T 11: 100,893,125 G658R probably damaging Het
Tnfrsf11a A G 1: 105,827,739 probably null Het
Tnk2 G T 16: 32,670,796 A298S probably damaging Het
Vmn1r218 T C 13: 23,136,801 V26A possibly damaging Het
Wipf3 G A 6: 54,481,828 G56D probably damaging Het
Other mutations in Cdc27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Cdc27 APN 11 104521432 missense probably benign 0.01
IGL00673:Cdc27 APN 11 104528435 missense probably damaging 1.00
IGL00949:Cdc27 APN 11 104529403 missense probably damaging 1.00
IGL01529:Cdc27 APN 11 104507216 missense probably damaging 1.00
IGL01894:Cdc27 APN 11 104526921 missense probably benign 0.00
IGL02096:Cdc27 APN 11 104528568 splice site probably benign
IGL02124:Cdc27 APN 11 104522731 missense probably damaging 0.99
IGL02444:Cdc27 APN 11 104522716 splice site probably benign
IGL02589:Cdc27 APN 11 104505644 missense probably benign 0.04
IGL02851:Cdc27 APN 11 104526981 splice site probably benign
IGL02861:Cdc27 APN 11 104522831 splice site probably benign
IGL02952:Cdc27 APN 11 104517464 missense probably damaging 1.00
IGL03103:Cdc27 APN 11 104512980 missense probably benign 0.21
R0344:Cdc27 UTSW 11 104526991 splice site probably benign
R0365:Cdc27 UTSW 11 104528424 missense possibly damaging 0.68
R0366:Cdc27 UTSW 11 104505648 missense probably damaging 0.99
R0426:Cdc27 UTSW 11 104513027 splice site probably null
R0505:Cdc27 UTSW 11 104528288 missense probably benign
R0639:Cdc27 UTSW 11 104531734 missense probably damaging 1.00
R0925:Cdc27 UTSW 11 104526049 critical splice donor site probably null
R0927:Cdc27 UTSW 11 104505641 missense possibly damaging 0.88
R1414:Cdc27 UTSW 11 104521425 missense probably benign 0.26
R1765:Cdc27 UTSW 11 104534781 missense probably damaging 1.00
R1822:Cdc27 UTSW 11 104522822 missense probably benign 0.16
R2449:Cdc27 UTSW 11 104505638 missense probably benign 0.03
R3404:Cdc27 UTSW 11 104507200 missense probably damaging 1.00
R3405:Cdc27 UTSW 11 104507200 missense probably damaging 1.00
R3406:Cdc27 UTSW 11 104507200 missense probably damaging 1.00
R3776:Cdc27 UTSW 11 104515437 missense probably damaging 1.00
R4385:Cdc27 UTSW 11 104534814 missense probably benign 0.10
R4451:Cdc27 UTSW 11 104517395 missense probably benign 0.05
R4452:Cdc27 UTSW 11 104517395 missense probably benign 0.05
R4530:Cdc27 UTSW 11 104528426 missense possibly damaging 0.68
R4956:Cdc27 UTSW 11 104529395 missense probably damaging 0.99
R4988:Cdc27 UTSW 11 104526124 missense possibly damaging 0.95
R5098:Cdc27 UTSW 11 104507287 missense probably damaging 1.00
R5130:Cdc27 UTSW 11 104534774 missense probably benign 0.07
R5384:Cdc27 UTSW 11 104507140 missense probably benign 0.02
R5876:Cdc27 UTSW 11 104515418 missense probably benign 0.30
R6238:Cdc27 UTSW 11 104528444 missense probably damaging 1.00
R6318:Cdc27 UTSW 11 104528694 missense probably damaging 1.00
R6354:Cdc27 UTSW 11 104534748 missense probably damaging 1.00
R6467:Cdc27 UTSW 11 104522776 missense probably damaging 1.00
R6485:Cdc27 UTSW 11 104505648 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- ACACAGCACACCGGATTTAGG -3'
(R):5'- TGTTGGAGAAAAGCATCCTCCC -3'

Sequencing Primer
(F):5'- GCACACCGGATTTAGGAGTAATTAC -3'
(R):5'- CACCTGAATGGGCTTGTACTTCAAAG -3'
Posted On2015-04-30