Incidental Mutation 'R4037:Gpr137c'
ID313767
Institutional Source Beutler Lab
Gene Symbol Gpr137c
Ensembl Gene ENSMUSG00000049092
Gene NameG protein-coupled receptor 137C
SynonymsLOC380893, 6330416L11Rik, TM7SF1L2
MMRRC Submission 040964-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R4037 (G1)
Quality Score131
Status Validated
Chromosome14
Chromosomal Location45219717-45282725 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 45220230 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 80 (L80I)
Ref Sequence ENSEMBL: ENSMUSP00000154316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022377] [ENSMUST00000123879] [ENSMUST00000128484] [ENSMUST00000139526] [ENSMUST00000143609] [ENSMUST00000146150] [ENSMUST00000147853] [ENSMUST00000147957] [ENSMUST00000153383] [ENSMUST00000226879] [ENSMUST00000227009] [ENSMUST00000227056] [ENSMUST00000227086]
Predicted Effect probably benign
Transcript: ENSMUST00000022377
SMART Domains Protein: ENSMUSP00000022377
Gene: ENSMUSG00000021830

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 354 367 N/A INTRINSIC
Pfam:Thioredoxin 394 496 1.9e-12 PFAM
Pfam:Thioredoxin_6 534 723 2.3e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123118
Predicted Effect probably benign
Transcript: ENSMUST00000123879
SMART Domains Protein: ENSMUSP00000123023
Gene: ENSMUSG00000021830

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 354 367 N/A INTRINSIC
Pfam:Thioredoxin 394 496 1.9e-12 PFAM
Pfam:Thioredoxin_6 534 723 2.3e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128484
Predicted Effect probably benign
Transcript: ENSMUST00000139526
SMART Domains Protein: ENSMUSP00000120287
Gene: ENSMUSG00000021830

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 354 367 N/A INTRINSIC
Pfam:Thioredoxin 394 496 1e-12 PFAM
Pfam:Thioredoxin_6 534 723 7.3e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143609
SMART Domains Protein: ENSMUSP00000122128
Gene: ENSMUSG00000021830

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000146150
AA Change: L80I

PolyPhen 2 Score 0.519 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000120015
Gene: ENSMUSG00000049092
AA Change: L80I

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
low complexity region 23 39 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
transmembrane domain 78 100 N/A INTRINSIC
Blast:G_alpha 121 286 9e-17 BLAST
transmembrane domain 294 316 N/A INTRINSIC
low complexity region 376 389 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147853
Predicted Effect possibly damaging
Transcript: ENSMUST00000147957
AA Change: L80I

PolyPhen 2 Score 0.519 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150648
Predicted Effect probably benign
Transcript: ENSMUST00000153383
Predicted Effect probably benign
Transcript: ENSMUST00000226879
Predicted Effect unknown
Transcript: ENSMUST00000226915
AA Change: P20H
Predicted Effect probably damaging
Transcript: ENSMUST00000227009
AA Change: L80I

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000227056
AA Change: L72I

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000227086
AA Change: L80I

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Meta Mutation Damage Score 0.132 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 93% (37/40)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 A G 15: 64,725,470 F881L probably benign Het
Capn6 A G X: 143,807,863 W291R probably damaging Het
Cdc27 T C 11: 104,507,207 I776V probably damaging Het
Cpne5 C T 17: 29,159,113 R564H unknown Het
Crnkl1 T A 2: 145,932,327 D72V possibly damaging Het
Dcc A G 18: 72,350,397 L17P possibly damaging Het
Dhcr24 T C 4: 106,573,878 F255L probably benign Het
Eef2kmt A T 16: 5,245,271 V335D probably damaging Het
Efcc1 C T 6: 87,731,508 Q206* probably null Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Hcls1 A G 16: 36,956,625 T226A possibly damaging Het
Hmcn1 T A 1: 150,772,502 T678S probably benign Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Hspb8 A G 5: 116,409,344 V193A probably benign Het
Man1c1 C T 4: 134,593,339 D217N probably damaging Het
Metrn T C 17: 25,795,010 T281A probably benign Het
Mmachc T A 4: 116,706,018 T47S probably damaging Het
Ncoa6 G A 2: 155,407,370 S1338L probably damaging Het
Ogfrl1 T C 1: 23,378,964 probably benign Het
Olfr1218 A G 2: 89,054,688 V246A probably damaging Het
Olfr1246 C T 2: 89,591,035 V27I probably benign Het
Pax4 A G 6: 28,443,883 I241T probably benign Het
Prkaa2 T C 4: 105,051,247 N144D probably damaging Het
Rims1 T C 1: 22,475,712 S537G probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Ruvbl1 T A 6: 88,473,135 M96K probably damaging Het
Sdk2 T C 11: 113,795,055 I1880V probably damaging Het
Sis T C 3: 72,928,602 N885D probably benign Het
Skint5 G T 4: 113,885,814 T352K unknown Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc36a2 T C 11: 55,164,275 D318G probably benign Het
Slc38a4 G A 15: 96,997,042 A531V probably benign Het
Stat3 C T 11: 100,893,125 G658R probably damaging Het
Tnfrsf11a A G 1: 105,827,739 probably null Het
Tnk2 G T 16: 32,670,796 A298S probably damaging Het
Vmn1r218 T C 13: 23,136,801 V26A possibly damaging Het
Wipf3 G A 6: 54,481,828 G56D probably damaging Het
Other mutations in Gpr137c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Gpr137c APN 14 45278745 missense probably damaging 0.97
IGL02167:Gpr137c APN 14 45279955 missense probably damaging 0.98
IGL02203:Gpr137c APN 14 45277487 missense possibly damaging 0.86
IGL02960:Gpr137c APN 14 45246433 missense possibly damaging 0.92
R0731:Gpr137c UTSW 14 45246349 missense probably damaging 1.00
R1162:Gpr137c UTSW 14 45244158 missense possibly damaging 0.89
R1245:Gpr137c UTSW 14 45279065 utr 3 prime probably benign
R1983:Gpr137c UTSW 14 45279971 missense probably benign 0.01
R2060:Gpr137c UTSW 14 45244159 missense probably damaging 1.00
R2428:Gpr137c UTSW 14 45278963 missense probably damaging 1.00
R3034:Gpr137c UTSW 14 45220276 missense probably damaging 0.99
R3911:Gpr137c UTSW 14 45278935 missense probably benign 0.31
R4038:Gpr137c UTSW 14 45220230 missense probably damaging 0.99
R4213:Gpr137c UTSW 14 45246508 missense probably damaging 0.99
R4986:Gpr137c UTSW 14 45246286 critical splice acceptor site probably null
R5521:Gpr137c UTSW 14 45278694 missense possibly damaging 0.92
R6028:Gpr137c UTSW 14 45277481 missense probably damaging 0.96
R7117:Gpr137c UTSW 14 45279027 missense probably damaging 1.00
R7238:Gpr137c UTSW 14 45278691 missense probably damaging 1.00
R7365:Gpr137c UTSW 14 45279014 missense probably damaging 1.00
X0027:Gpr137c UTSW 14 45278669 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- CATGAGGGTATCAGTGTCCG -3'
(R):5'- ACAGGAGTGTCTCAGTGTCC -3'

Sequencing Primer
(F):5'- TATCAGTGTCCGGGCCG -3'
(R):5'- AGTGTCTCAGTGTCCCCAGAC -3'
Posted On2015-04-30