Incidental Mutation 'R4037:Capn6'
ID313778
Institutional Source Beutler Lab
Gene Symbol Capn6
Ensembl Gene ENSMUSG00000067276
Gene Namecalpain 6
Synonyms
MMRRC Submission 040964-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R4037 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location143802231-143827414 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 143807863 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 291 (W291R)
Ref Sequence ENSEMBL: ENSMUSP00000084573 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087316]
Predicted Effect probably damaging
Transcript: ENSMUST00000087316
AA Change: W291R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084573
Gene: ENSMUSG00000067276
AA Change: W291R

DomainStartEndE-ValueType
CysPc 8 351 1.53e-205 SMART
calpain_III 350 495 1.68e-56 SMART
C2 517 620 3.4e-9 SMART
Meta Mutation Damage Score 0.6468 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 93% (37/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calpains are ubiquitous, well-conserved family of calcium-dependent, cysteine proteases. The calpain proteins are heterodimers consisting of an invariant small subunit and variable large subunits. The large subunit possesses a cysteine protease domain, and both subunits possess calcium-binding domains. Calpains have been implicated in neurodegenerative processes, as their activation can be triggered by calcium influx and oxidative stress. The protein encoded by this gene is highly expressed in the placenta. Its C-terminal region lacks any homology to the calmodulin-like domain of other calpains. The protein lacks critical active site residues and thus is suggested to be proteolytically inactive. The protein may play a role in tumor formation by inhibiting apoptosis and promoting angiogenesis. [provided by RefSeq, Nov 2009]
PHENOTYPE: Female mice homozygous for a knock-out allele display advanced skeletal muscle development during embryogenesis and advanced skeletal muscle regeneration after cardiotoxin-induced degeneration. Male hemizygotes exhibit increased differentiation of primary cultured skeletal muscle cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 A G 15: 64,725,470 F881L probably benign Het
Cdc27 T C 11: 104,507,207 I776V probably damaging Het
Cpne5 C T 17: 29,159,113 R564H unknown Het
Crnkl1 T A 2: 145,932,327 D72V possibly damaging Het
Dcc A G 18: 72,350,397 L17P possibly damaging Het
Dhcr24 T C 4: 106,573,878 F255L probably benign Het
Eef2kmt A T 16: 5,245,271 V335D probably damaging Het
Efcc1 C T 6: 87,731,508 Q206* probably null Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Gpr137c C A 14: 45,220,230 L80I probably damaging Het
Hcls1 A G 16: 36,956,625 T226A possibly damaging Het
Hmcn1 T A 1: 150,772,502 T678S probably benign Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Hspb8 A G 5: 116,409,344 V193A probably benign Het
Man1c1 C T 4: 134,593,339 D217N probably damaging Het
Metrn T C 17: 25,795,010 T281A probably benign Het
Mmachc T A 4: 116,706,018 T47S probably damaging Het
Ncoa6 G A 2: 155,407,370 S1338L probably damaging Het
Ogfrl1 T C 1: 23,378,964 probably benign Het
Olfr1218 A G 2: 89,054,688 V246A probably damaging Het
Olfr1246 C T 2: 89,591,035 V27I probably benign Het
Pax4 A G 6: 28,443,883 I241T probably benign Het
Prkaa2 T C 4: 105,051,247 N144D probably damaging Het
Rims1 T C 1: 22,475,712 S537G probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Ruvbl1 T A 6: 88,473,135 M96K probably damaging Het
Sdk2 T C 11: 113,795,055 I1880V probably damaging Het
Sis T C 3: 72,928,602 N885D probably benign Het
Skint5 G T 4: 113,885,814 T352K unknown Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc36a2 T C 11: 55,164,275 D318G probably benign Het
Slc38a4 G A 15: 96,997,042 A531V probably benign Het
Stat3 C T 11: 100,893,125 G658R probably damaging Het
Tnfrsf11a A G 1: 105,827,739 probably null Het
Tnk2 G T 16: 32,670,796 A298S probably damaging Het
Vmn1r218 T C 13: 23,136,801 V26A possibly damaging Het
Wipf3 G A 6: 54,481,828 G56D probably damaging Het
Other mutations in Capn6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01110:Capn6 APN X 143807250 missense probably damaging 1.00
IGL02486:Capn6 APN X 143804677 missense probably benign 0.00
R2228:Capn6 UTSW X 143804789 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- AGAATGCACAACGACTAGGC -3'
(R):5'- ATCATACTGGGATGAACCAACC -3'

Sequencing Primer
(F):5'- GCTTACTTTATTTTATTTCTGGCTCG -3'
(R):5'- ATTTGCTATCAGTCTCCCAGCCAG -3'
Posted On2015-04-30