Incidental Mutation 'R4039:Gorab'
ID313822
Institutional Source Beutler Lab
Gene Symbol Gorab
Ensembl Gene ENSMUSG00000040124
Gene Namegolgin, RAB6-interacting
SynonymsNTKL-BP1, Scyl1bp1
MMRRC Submission 041614-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.341) question?
Stock #R4039 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location163384908-163403669 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 163397066 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 55 (D55E)
Ref Sequence ENSEMBL: ENSMUSP00000140320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045138] [ENSMUST00000186402]
Predicted Effect probably benign
Transcript: ENSMUST00000045138
AA Change: D55E

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000036253
Gene: ENSMUSG00000040124
AA Change: D55E

DomainStartEndE-ValueType
Pfam:Transcrip_act 128 276 9.3e-11 PFAM
low complexity region 277 301 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185299
Predicted Effect possibly damaging
Transcript: ENSMUST00000186402
AA Change: D55E

PolyPhen 2 Score 0.647 (Sensitivity: 0.87; Specificity: 0.91)
Meta Mutation Damage Score 0.0588 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the golgin family, a group of coiled-coil proteins localized to the Golgi. The encoded protein may function in the secretory pathway. The encoded protein, which also localizes to the cytoplasm, was identified by interactions with the N-terminal kinase-like protein, and thus it may function in mitosis. Mutations in this gene have been associated with geroderma osteodysplastica. Alternatively spliced transcript variants have been described. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a null gene trap allele exhibit hunched posture, craniofacial abnormalities, neonatal lethality, respiratory distress, skin edema, decreased hair follicles, fewer dermal condensates and papillae, and impaired formation of primary cilia on dermal condensate cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933412E24Rik A T 15: 60,016,366 L75Q possibly damaging Het
Cep290 T C 10: 100,512,401 probably null Het
Col11a2 A G 17: 34,045,774 T268A probably benign Het
Crnkl1 T A 2: 145,932,327 D72V possibly damaging Het
Csn2 C T 5: 87,698,076 M1I probably null Het
Dhcr24 T C 4: 106,573,878 F255L probably benign Het
Epn2 A G 11: 61,546,522 Y75H probably damaging Het
Galnt3 A T 2: 66,085,327 H563Q probably damaging Het
Galnt9 T C 5: 110,614,208 V37A probably damaging Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Herc2 G A 7: 56,156,411 R2318Q probably damaging Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Hspb8 A G 5: 116,409,344 V193A probably benign Het
Ly75 A G 2: 60,352,995 L481P probably damaging Het
Lyzl1 T C 18: 4,169,140 L48P probably damaging Het
Mettl27 C T 5: 134,940,609 Q212* probably null Het
Mmachc T A 4: 116,706,018 T47S probably damaging Het
Ncam2 C T 16: 81,490,323 S375L probably benign Het
Ogfrl1 T C 1: 23,378,964 probably benign Het
Parp9 T C 16: 35,960,047 L461P probably damaging Het
Pcsk7 A G 9: 45,928,007 probably null Het
Plekhh1 C A 12: 79,055,183 H342Q probably benign Het
Prdm13 T G 4: 21,685,774 probably benign Het
Prkaa2 T C 4: 105,051,247 N144D probably damaging Het
Ptpn12 A T 5: 21,002,510 Y283* probably null Het
Rab12 T C 17: 66,500,401 Y111C possibly damaging Het
Ralgapa1 T C 12: 55,795,701 N61S probably damaging Het
Rims1 T C 1: 22,475,712 S537G probably damaging Het
Sash1 G T 10: 8,729,627 P1000T probably damaging Het
Skint5 G T 4: 113,885,814 T352K unknown Het
Slc12a5 A G 2: 164,992,330 E757G probably benign Het
Sycp2 C A 2: 178,380,927 M470I possibly damaging Het
Szt2 T C 4: 118,364,952 probably benign Het
Tbc1d1 A G 5: 64,316,428 T765A probably damaging Het
Tgfbr2 T C 9: 116,175,037 M1V probably null Het
Tnfrsf11a A G 1: 105,827,739 probably null Het
Trim43b A G 9: 89,091,347 L111P probably damaging Het
Ttbk2 A T 2: 120,745,795 S900R probably benign Het
Unc79 G A 12: 103,074,949 C747Y possibly damaging Het
Vmn1r218 T C 13: 23,136,801 V26A possibly damaging Het
Vmn2r115 A T 17: 23,345,103 Y83F probably benign Het
Zfp536 A T 7: 37,569,550 L147Q probably damaging Het
Zfp931 T A 2: 178,067,984 Q203L possibly damaging Het
Zswim2 G A 2: 83,915,994 H367Y probably damaging Het
Other mutations in Gorab
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Gorab APN 1 163394687 missense probably damaging 1.00
IGL00915:Gorab APN 1 163396857 missense probably benign 0.00
IGL01645:Gorab APN 1 163386431 missense possibly damaging 0.46
R0387:Gorab UTSW 1 163396834 missense probably benign 0.20
R0504:Gorab UTSW 1 163386605 missense probably damaging 1.00
R0612:Gorab UTSW 1 163397169 missense possibly damaging 0.93
R1863:Gorab UTSW 1 163403562 missense probably damaging 1.00
R1991:Gorab UTSW 1 163397056 missense probably damaging 0.99
R1992:Gorab UTSW 1 163397056 missense probably damaging 0.99
R2844:Gorab UTSW 1 163396806 splice site probably null
R4527:Gorab UTSW 1 163397136 missense possibly damaging 0.94
R4864:Gorab UTSW 1 163386398 missense probably benign
R5175:Gorab UTSW 1 163386645 missense probably damaging 1.00
R5470:Gorab UTSW 1 163392509 missense probably damaging 1.00
R5485:Gorab UTSW 1 163386302 missense possibly damaging 0.55
R6265:Gorab UTSW 1 163386630 missense possibly damaging 0.54
R6314:Gorab UTSW 1 163397089 missense probably damaging 1.00
R6355:Gorab UTSW 1 163386569 missense probably damaging 1.00
Z1088:Gorab UTSW 1 163386323 missense possibly damaging 0.56
Z1088:Gorab UTSW 1 163403550 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGTGGGAATTCTCAAGTCC -3'
(R):5'- GGAAGGGGCCCTTAGAATTG -3'

Sequencing Primer
(F):5'- GGGAATTCTCAAGTCCTGGTTC -3'
(R):5'- GAATTGCAAAAATTTAATGCCACTAC -3'
Posted On2015-04-30