Incidental Mutation 'R4039:Galnt3'
ID313824
Institutional Source Beutler Lab
Gene Symbol Galnt3
Ensembl Gene ENSMUSG00000026994
Gene Namepolypeptide N-acetylgalactosaminyltransferase 3
SynonymsppGaNTase-T3
MMRRC Submission 041614-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.333) question?
Stock #R4039 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location66082766-66124994 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 66085327 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 563 (H563Q)
Ref Sequence ENSEMBL: ENSMUSP00000028378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028378]
Predicted Effect probably damaging
Transcript: ENSMUST00000028378
AA Change: H563Q

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000028378
Gene: ENSMUSG00000026994
AA Change: H563Q

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
coiled coil region 44 75 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 185 440 8.3e-10 PFAM
Pfam:Glycos_transf_2 188 374 1.2e-35 PFAM
Pfam:Glyco_transf_7C 345 423 7.7e-14 PFAM
RICIN 506 630 2.71e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155453
Meta Mutation Damage Score 0.046 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes UDP-GalNAc transferase 3, a member of the GalNAc-transferases family. This family transfers an N-acetyl galactosamine to the hydroxyl group of a serine or threonine residue in the first step of O-linked oligosaccharide biosynthesis. Individual GalNAc-transferases have distinct activities and initiation of O-glycosylation is regulated by a repertoire of GalNAc-transferases. The protein encoded by this gene is highly homologous to other family members, however the enzymes have different substrate specificities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased circulating alkaline phosphatase, hypercalcemia, hyperphosphatemia, decreased circulating parathyroid hormone, and male specific postnatal growth retardation, infertility, and increase in bone density. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933412E24Rik A T 15: 60,016,366 L75Q possibly damaging Het
Cep290 T C 10: 100,512,401 probably null Het
Col11a2 A G 17: 34,045,774 T268A probably benign Het
Crnkl1 T A 2: 145,932,327 D72V possibly damaging Het
Csn2 C T 5: 87,698,076 M1I probably null Het
Dhcr24 T C 4: 106,573,878 F255L probably benign Het
Epn2 A G 11: 61,546,522 Y75H probably damaging Het
Galnt9 T C 5: 110,614,208 V37A probably damaging Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Gorab A T 1: 163,397,066 D55E possibly damaging Het
Herc2 G A 7: 56,156,411 R2318Q probably damaging Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Hspb8 A G 5: 116,409,344 V193A probably benign Het
Ly75 A G 2: 60,352,995 L481P probably damaging Het
Lyzl1 T C 18: 4,169,140 L48P probably damaging Het
Mettl27 C T 5: 134,940,609 Q212* probably null Het
Mmachc T A 4: 116,706,018 T47S probably damaging Het
Ncam2 C T 16: 81,490,323 S375L probably benign Het
Ogfrl1 T C 1: 23,378,964 probably benign Het
Parp9 T C 16: 35,960,047 L461P probably damaging Het
Pcsk7 A G 9: 45,928,007 probably null Het
Plekhh1 C A 12: 79,055,183 H342Q probably benign Het
Prdm13 T G 4: 21,685,774 probably benign Het
Prkaa2 T C 4: 105,051,247 N144D probably damaging Het
Ptpn12 A T 5: 21,002,510 Y283* probably null Het
Rab12 T C 17: 66,500,401 Y111C possibly damaging Het
Ralgapa1 T C 12: 55,795,701 N61S probably damaging Het
Rims1 T C 1: 22,475,712 S537G probably damaging Het
Sash1 G T 10: 8,729,627 P1000T probably damaging Het
Skint5 G T 4: 113,885,814 T352K unknown Het
Slc12a5 A G 2: 164,992,330 E757G probably benign Het
Sycp2 C A 2: 178,380,927 M470I possibly damaging Het
Szt2 T C 4: 118,364,952 probably benign Het
Tbc1d1 A G 5: 64,316,428 T765A probably damaging Het
Tgfbr2 T C 9: 116,175,037 M1V probably null Het
Tnfrsf11a A G 1: 105,827,739 probably null Het
Trim43b A G 9: 89,091,347 L111P probably damaging Het
Ttbk2 A T 2: 120,745,795 S900R probably benign Het
Unc79 G A 12: 103,074,949 C747Y possibly damaging Het
Vmn1r218 T C 13: 23,136,801 V26A possibly damaging Het
Vmn2r115 A T 17: 23,345,103 Y83F probably benign Het
Zfp536 A T 7: 37,569,550 L147Q probably damaging Het
Zfp931 T A 2: 178,067,984 Q203L possibly damaging Het
Zswim2 G A 2: 83,915,994 H367Y probably damaging Het
Other mutations in Galnt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Galnt3 APN 2 66095284 missense probably damaging 1.00
IGL01563:Galnt3 APN 2 66097757 missense probably damaging 0.97
IGL01973:Galnt3 APN 2 66084262 missense probably benign 0.03
IGL02004:Galnt3 APN 2 66095926 missense probably damaging 1.00
IGL02424:Galnt3 APN 2 66095788 critical splice donor site probably null
IGL02946:Galnt3 APN 2 66095218 missense probably damaging 0.99
IGL03059:Galnt3 APN 2 66093610 missense probably damaging 1.00
R0437:Galnt3 UTSW 2 66107229 missense possibly damaging 0.74
R1390:Galnt3 UTSW 2 66091223 missense probably damaging 1.00
R1536:Galnt3 UTSW 2 66084206 missense probably damaging 1.00
R1869:Galnt3 UTSW 2 66097779 missense possibly damaging 0.82
R2987:Galnt3 UTSW 2 66084241 missense probably benign 0.00
R3973:Galnt3 UTSW 2 66107030 missense possibly damaging 0.77
R4515:Galnt3 UTSW 2 66093610 missense probably damaging 1.00
R4518:Galnt3 UTSW 2 66093610 missense probably damaging 1.00
R4519:Galnt3 UTSW 2 66093610 missense probably damaging 1.00
R4577:Galnt3 UTSW 2 66097859 missense probably benign 0.02
R4817:Galnt3 UTSW 2 66093539 missense possibly damaging 0.83
R5008:Galnt3 UTSW 2 66085241 missense probably benign 0.04
R5191:Galnt3 UTSW 2 66093706 missense probably damaging 1.00
R5947:Galnt3 UTSW 2 66084156 utr 3 prime probably benign
R6534:Galnt3 UTSW 2 66102531 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTCACCTACAGAAGCCAAGC -3'
(R):5'- TCCACAGAGCCTGTCGTAAC -3'

Sequencing Primer
(F):5'- GCCAAGCGTAACTTTATCACTAG -3'
(R):5'- GAGCCTGTCGTAACTAATGCC -3'
Posted On2015-04-30