Incidental Mutation 'R0387:Dync2li1'
ID31383
Institutional Source Beutler Lab
Gene Symbol Dync2li1
Ensembl Gene ENSMUSG00000024253
Gene Namedynein cytoplasmic 2 light intermediate chain 1
SynonymsmD2LIC, 4933404O11Rik, LIC3, D2lic, CGI-60
MMRRC Submission 038593-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0387 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location84626496-84655558 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84655340 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 345 (K345E)
Ref Sequence ENSEMBL: ENSMUSP00000025101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025101] [ENSMUST00000066175] [ENSMUST00000163375]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025101
AA Change: K345E

PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000025101
Gene: ENSMUSG00000024253
AA Change: K345E

DomainStartEndE-ValueType
Pfam:DLIC 2 179 3.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066175
SMART Domains Protein: ENSMUSP00000069495
Gene: ENSMUSG00000040505

DomainStartEndE-ValueType
AAA 79 271 2.28e-11 SMART
Pfam:ABC2_membrane 367 581 1.3e-24 PFAM
transmembrane domain 621 643 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163375
SMART Domains Protein: ENSMUSP00000130783
Gene: ENSMUSG00000040505

DomainStartEndE-ValueType
Pfam:ABC_tran 1 134 7.8e-17 PFAM
Pfam:ABC2_membrane 195 409 1.4e-23 PFAM
transmembrane domain 449 471 N/A INTRINSIC
Meta Mutation Damage Score 0.146 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.7%
  • 10x: 94.2%
  • 20x: 85.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a component of the dynein-2 microtubule motor protein complex that plays a role in the retrograde transport of cargo in primary cilia via the intraflagellar transport system. This gene is ubiquitously expressed and its protein, which localizes to the axoneme and Golgi apparatus, interacts directly with the cytoplasmic dynein 2 heavy chain 1 protein to form part of the multi-protein dynein-2 complex. Mutations in this gene produce defects in the dynein-2 complex which result in several types of ciliopathy including short-rib thoracic dysplasia 15 with polydactyly (SRTD15). Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for disruptions in this allele die before embryonic day 11.5. They display neural tube defects in addition to a variety developmental patterning abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T G 7: 120,332,852 probably null Het
Abcc9 T A 6: 142,639,504 K825* probably null Het
Afp T C 5: 90,497,291 C189R probably damaging Het
Akap9 T C 5: 3,951,678 probably benign Het
Alpk3 A T 7: 81,104,227 T1652S possibly damaging Het
Atg4b C A 1: 93,786,556 Q354K probably benign Het
Atxn2 T C 5: 121,802,143 S388P possibly damaging Het
C2cd3 T A 7: 100,422,507 probably benign Het
Cacna2d2 C A 9: 107,513,881 T403K probably damaging Het
Cap2 C T 13: 46,560,516 H79Y probably damaging Het
Car10 G T 11: 93,583,021 probably null Het
Ccno T C 13: 112,989,867 L290P probably damaging Het
Cfap69 T C 5: 5,589,303 K624E probably damaging Het
Ctnna3 A G 10: 64,586,130 M568V probably benign Het
Cyp1b1 C A 17: 79,713,774 V180L probably benign Het
Cyp2u1 G T 3: 131,295,552 probably null Het
Dcp1a T C 14: 30,519,679 probably null Het
Dnm1 C T 2: 32,320,581 G1S possibly damaging Het
Dnmt1 A G 9: 20,918,213 L698P probably damaging Het
Dock10 C A 1: 80,540,276 C1327F probably damaging Het
Dph3b-ps A G 13: 106,546,855 noncoding transcript Het
Dpyd G A 3: 119,427,226 D949N probably benign Het
Eml2 T A 7: 19,182,259 probably null Het
Exoc7 A G 11: 116,294,401 probably benign Het
Faah A T 4: 116,005,692 C113* probably null Het
Fcf1 T A 12: 84,973,002 D16E probably benign Het
Fcgbp T C 7: 28,091,454 probably benign Het
Ghr A G 15: 3,319,891 S602P probably benign Het
Gm10334 A G 6: 41,443,369 I141T possibly damaging Het
Gm5114 T C 7: 39,408,809 D462G probably benign Het
Gm8186 T A 17: 26,099,026 S66C probably damaging Het
Gorab C T 1: 163,396,834 V133M probably benign Het
Gria1 G A 11: 57,309,884 probably null Het
Grik1 T A 16: 88,034,350 probably benign Het
Gtf3c1 A G 7: 125,681,104 L378P probably damaging Het
Htr5b A T 1: 121,527,546 V215D probably damaging Het
Htra1 A G 7: 130,979,478 T319A probably damaging Het
Idh2 C T 7: 80,098,257 A232T probably damaging Het
Klrb1a A C 6: 128,609,734 H189Q possibly damaging Het
Lhfp A G 3: 53,043,328 T8A probably benign Het
Ly75 T A 2: 60,306,404 Y1493F probably benign Het
Mfsd5 T C 15: 102,281,096 I301T possibly damaging Het
Mlkl C T 8: 111,333,350 E135K probably damaging Het
Mrgprx2 A C 7: 48,499,160 M1R probably null Het
Mroh2a G C 1: 88,246,042 A871P probably damaging Het
Mtbp A G 15: 55,611,029 I280V possibly damaging Het
Myo5c A T 9: 75,285,021 probably benign Het
Nos3 A G 5: 24,367,585 K174R probably damaging Het
Oas2 A T 5: 120,745,672 probably benign Het
Olfr889 T A 9: 38,115,770 probably null Het
Pi4kb G C 3: 94,984,740 E256Q probably benign Het
Pik3c2a T A 7: 116,373,744 I739F probably damaging Het
Pla2r1 T A 2: 60,432,601 K1031N probably benign Het
Plk4 A T 3: 40,812,884 probably benign Het
Polq T C 16: 37,029,430 C349R probably damaging Het
Polq G T 16: 37,089,317 E2354D probably damaging Het
Prss22 A G 17: 23,993,929 L278P probably damaging Het
Ptprk G A 10: 28,354,629 V239I possibly damaging Het
Raph1 T G 1: 60,510,496 probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ripor3 C T 2: 167,983,772 W755* probably null Het
Rnd3 G T 2: 51,148,231 D77E probably damaging Het
Ryr1 T C 7: 29,083,367 probably benign Het
Serpinb1a C T 13: 32,848,738 V63I probably benign Het
Six1 T G 12: 73,046,041 Y129S probably damaging Het
Spata31d1a G A 13: 59,703,501 T271I probably damaging Het
Stab1 T C 14: 31,148,101 D1387G probably benign Het
Stra6 T A 9: 58,153,183 M625K probably benign Het
Syne1 T C 10: 5,351,029 S900G probably benign Het
Tdpoz4 A C 3: 93,796,700 K101N probably benign Het
Tigd2 T C 6: 59,211,158 Y337H probably benign Het
Tnxb A G 17: 34,683,574 I1134V probably benign Het
Tspyl5 A G 15: 33,686,935 I288T probably damaging Het
Ulk1 A G 5: 110,788,797 V61A possibly damaging Het
Xxylt1 A G 16: 30,957,376 Y381H probably benign Het
Zcchc9 T A 13: 91,800,947 M12L probably benign Het
Zfp106 T C 2: 120,528,472 probably null Het
Zfp74 T A 7: 29,934,754 T510S probably benign Het
Zfp808 A G 13: 62,169,478 T14A probably damaging Het
Other mutations in Dync2li1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Dync2li1 APN 17 84644726 missense possibly damaging 0.86
IGL00661:Dync2li1 APN 17 84649240 missense possibly damaging 0.88
IGL01450:Dync2li1 APN 17 84633556 missense possibly damaging 0.53
IGL01610:Dync2li1 APN 17 84628314 missense probably damaging 1.00
R0883:Dync2li1 UTSW 17 84649271 missense probably benign 0.01
R1499:Dync2li1 UTSW 17 84647239 splice site probably benign
R1823:Dync2li1 UTSW 17 84649797 missense probably damaging 0.98
R2164:Dync2li1 UTSW 17 84636274 missense probably damaging 1.00
R2394:Dync2li1 UTSW 17 84644747 missense possibly damaging 0.94
R2443:Dync2li1 UTSW 17 84647665 missense probably benign 0.30
R3901:Dync2li1 UTSW 17 84631642 missense probably damaging 1.00
R4151:Dync2li1 UTSW 17 84628335 missense probably benign 0.00
R4934:Dync2li1 UTSW 17 84649255 missense probably benign
R4960:Dync2li1 UTSW 17 84633541 missense probably benign 0.07
R5340:Dync2li1 UTSW 17 84649702 splice site probably null
R5841:Dync2li1 UTSW 17 84633562 missense probably damaging 1.00
R6230:Dync2li1 UTSW 17 84647650 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTAGTAGAGTCACAGAGCCGGTCTC -3'
(R):5'- TCTGAGTACACCTTCCAGAAGGACG -3'

Sequencing Primer
(F):5'- CAGAGCCGGTCTCAGGAAG -3'
(R):5'- cagaatccaaatggtacaaggag -3'
Posted On2013-04-24