Incidental Mutation 'R4039:Sycp2'
ID313830
Institutional Source Beutler Lab
Gene Symbol Sycp2
Ensembl Gene ENSMUSG00000060445
Gene Namesynaptonemal complex protein 2
Synonyms3830402K23Rik, 4930518F03Rik
MMRRC Submission 041614-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4039 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location178345293-178407685 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 178380927 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 470 (M470I)
Ref Sequence ENSEMBL: ENSMUSP00000079909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081134]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081134
AA Change: M470I

PolyPhen 2 Score 0.716 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000079909
Gene: ENSMUSG00000060445
AA Change: M470I

DomainStartEndE-ValueType
low complexity region 945 960 N/A INTRINSIC
low complexity region 1006 1019 N/A INTRINSIC
low complexity region 1076 1091 N/A INTRINSIC
low complexity region 1195 1204 N/A INTRINSIC
low complexity region 1273 1293 N/A INTRINSIC
low complexity region 1355 1364 N/A INTRINSIC
coiled coil region 1387 1429 N/A INTRINSIC
Meta Mutation Damage Score 0.126 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The synaptonemal complex is a proteinaceous structure that links homologous chromosomes during the prophase of meiosis. The protein encoded by this gene is a major component of the synaptonemal complex and may bind DNA at scaffold attachment regions. The encoded protein requires synaptonemal complex protein 3, but not 1, for inclusion in the synaptonemal complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male mice homozygous for a knock-out allele are sterile due to lack of axial element formation and subsequent failure of chromosome synapsis in prophase I spermatocytes, while females are subfertile with a sharply reduced litter size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933412E24Rik A T 15: 60,016,366 L75Q possibly damaging Het
Cep290 T C 10: 100,512,401 probably null Het
Col11a2 A G 17: 34,045,774 T268A probably benign Het
Crnkl1 T A 2: 145,932,327 D72V possibly damaging Het
Csn2 C T 5: 87,698,076 M1I probably null Het
Dhcr24 T C 4: 106,573,878 F255L probably benign Het
Epn2 A G 11: 61,546,522 Y75H probably damaging Het
Galnt3 A T 2: 66,085,327 H563Q probably damaging Het
Galnt9 T C 5: 110,614,208 V37A probably damaging Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Gorab A T 1: 163,397,066 D55E possibly damaging Het
Herc2 G A 7: 56,156,411 R2318Q probably damaging Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Hspb8 A G 5: 116,409,344 V193A probably benign Het
Ly75 A G 2: 60,352,995 L481P probably damaging Het
Lyzl1 T C 18: 4,169,140 L48P probably damaging Het
Mettl27 C T 5: 134,940,609 Q212* probably null Het
Mmachc T A 4: 116,706,018 T47S probably damaging Het
Ncam2 C T 16: 81,490,323 S375L probably benign Het
Ogfrl1 T C 1: 23,378,964 probably benign Het
Parp9 T C 16: 35,960,047 L461P probably damaging Het
Pcsk7 A G 9: 45,928,007 probably null Het
Plekhh1 C A 12: 79,055,183 H342Q probably benign Het
Prdm13 T G 4: 21,685,774 probably benign Het
Prkaa2 T C 4: 105,051,247 N144D probably damaging Het
Ptpn12 A T 5: 21,002,510 Y283* probably null Het
Rab12 T C 17: 66,500,401 Y111C possibly damaging Het
Ralgapa1 T C 12: 55,795,701 N61S probably damaging Het
Rims1 T C 1: 22,475,712 S537G probably damaging Het
Sash1 G T 10: 8,729,627 P1000T probably damaging Het
Skint5 G T 4: 113,885,814 T352K unknown Het
Slc12a5 A G 2: 164,992,330 E757G probably benign Het
Szt2 T C 4: 118,364,952 probably benign Het
Tbc1d1 A G 5: 64,316,428 T765A probably damaging Het
Tgfbr2 T C 9: 116,175,037 M1V probably null Het
Tnfrsf11a A G 1: 105,827,739 probably null Het
Trim43b A G 9: 89,091,347 L111P probably damaging Het
Ttbk2 A T 2: 120,745,795 S900R probably benign Het
Unc79 G A 12: 103,074,949 C747Y possibly damaging Het
Vmn1r218 T C 13: 23,136,801 V26A possibly damaging Het
Vmn2r115 A T 17: 23,345,103 Y83F probably benign Het
Zfp536 A T 7: 37,569,550 L147Q probably damaging Het
Zfp931 T A 2: 178,067,984 Q203L possibly damaging Het
Zswim2 G A 2: 83,915,994 H367Y probably damaging Het
Other mutations in Sycp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Sycp2 APN 2 178382348 missense probably damaging 1.00
IGL00578:Sycp2 APN 2 178350822 splice site probably benign
IGL00646:Sycp2 APN 2 178374459 missense probably benign 0.00
IGL01309:Sycp2 APN 2 178358111 missense probably benign 0.15
IGL01464:Sycp2 APN 2 178401632 missense probably damaging 0.96
IGL01539:Sycp2 APN 2 178374695 missense probably damaging 1.00
IGL01670:Sycp2 APN 2 178378050 missense probably benign 0.00
IGL02138:Sycp2 APN 2 178358254 missense probably benign 0.31
IGL02138:Sycp2 APN 2 178401990 nonsense probably null
IGL02630:Sycp2 APN 2 178401919 missense probably damaging 1.00
IGL02673:Sycp2 APN 2 178394211 missense possibly damaging 0.63
IGL02961:Sycp2 APN 2 178380862 missense probably benign 0.01
IGL03084:Sycp2 APN 2 178391791 unclassified probably benign
IGL03123:Sycp2 APN 2 178352479 nonsense probably null
IGL03167:Sycp2 APN 2 178379498 missense probably damaging 0.99
R0043:Sycp2 UTSW 2 178364711 missense probably damaging 1.00
R0050:Sycp2 UTSW 2 178364711 missense probably damaging 1.00
R0096:Sycp2 UTSW 2 178403735 missense probably damaging 0.99
R0096:Sycp2 UTSW 2 178403735 missense probably damaging 0.99
R0310:Sycp2 UTSW 2 178381855 missense probably benign 0.44
R0363:Sycp2 UTSW 2 178346411 splice site probably benign
R0456:Sycp2 UTSW 2 178381855 missense probably benign 0.44
R0597:Sycp2 UTSW 2 178356580 missense possibly damaging 0.54
R0608:Sycp2 UTSW 2 178382404 missense probably damaging 0.98
R1112:Sycp2 UTSW 2 178352536 missense probably benign 0.05
R1127:Sycp2 UTSW 2 178374366 missense possibly damaging 0.72
R1208:Sycp2 UTSW 2 178356628 missense possibly damaging 0.92
R1208:Sycp2 UTSW 2 178356628 missense possibly damaging 0.92
R1323:Sycp2 UTSW 2 178347621 missense possibly damaging 0.50
R1323:Sycp2 UTSW 2 178347621 missense possibly damaging 0.50
R1413:Sycp2 UTSW 2 178347797 missense probably benign 0.00
R1557:Sycp2 UTSW 2 178395216 unclassified probably benign
R1562:Sycp2 UTSW 2 178382385 missense probably damaging 1.00
R1585:Sycp2 UTSW 2 178351668 missense possibly damaging 0.50
R1932:Sycp2 UTSW 2 178381957 missense probably damaging 1.00
R1950:Sycp2 UTSW 2 178402800 missense probably benign 0.00
R2001:Sycp2 UTSW 2 178378055 missense probably benign 0.05
R2105:Sycp2 UTSW 2 178350138 splice site probably null
R2382:Sycp2 UTSW 2 178378018 critical splice donor site probably null
R2403:Sycp2 UTSW 2 178403735 nonsense probably null
R2483:Sycp2 UTSW 2 178374595 missense probably damaging 0.98
R3003:Sycp2 UTSW 2 178358123 missense probably benign 0.01
R3418:Sycp2 UTSW 2 178401653 splice site probably benign
R3686:Sycp2 UTSW 2 178374384 missense probably benign 0.16
R4038:Sycp2 UTSW 2 178380927 missense possibly damaging 0.72
R4272:Sycp2 UTSW 2 178358224 missense probably benign 0.04
R4343:Sycp2 UTSW 2 178380947 missense probably damaging 0.99
R4491:Sycp2 UTSW 2 178374985 missense probably damaging 1.00
R4534:Sycp2 UTSW 2 178355009 missense probably damaging 1.00
R4720:Sycp2 UTSW 2 178374432 missense probably benign 0.11
R4805:Sycp2 UTSW 2 178393961 unclassified probably benign
R4807:Sycp2 UTSW 2 178393961 unclassified probably benign
R4808:Sycp2 UTSW 2 178393961 unclassified probably benign
R4906:Sycp2 UTSW 2 178403657 critical splice donor site probably null
R4910:Sycp2 UTSW 2 178358224 missense probably benign 0.04
R5282:Sycp2 UTSW 2 178403761 missense probably damaging 1.00
R5285:Sycp2 UTSW 2 178392398 splice site probably null
R5316:Sycp2 UTSW 2 178356503 missense probably benign 0.00
R5389:Sycp2 UTSW 2 178377702 splice site probably null
R5621:Sycp2 UTSW 2 178381918 missense probably benign 0.05
R5652:Sycp2 UTSW 2 178358705 splice site probably null
R5880:Sycp2 UTSW 2 178374470 missense possibly damaging 0.92
R6114:Sycp2 UTSW 2 178348245 missense probably benign 0.25
R6115:Sycp2 UTSW 2 178348245 missense probably benign 0.25
R6186:Sycp2 UTSW 2 178383560 missense probably damaging 0.97
R6351:Sycp2 UTSW 2 178363416 missense probably damaging 1.00
R6509:Sycp2 UTSW 2 178395894 missense probably damaging 1.00
R6536:Sycp2 UTSW 2 178351648 missense probably damaging 1.00
R6679:Sycp2 UTSW 2 178380928 missense probably damaging 0.96
R6687:Sycp2 UTSW 2 178354960 missense probably damaging 0.99
R6761:Sycp2 UTSW 2 178374351 splice site probably null
R6786:Sycp2 UTSW 2 178383552 missense possibly damaging 0.63
Z1088:Sycp2 UTSW 2 178374367 missense probably benign
Z1088:Sycp2 UTSW 2 178381934 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GCCTCCTGCTTAATTCATGATAAAC -3'
(R):5'- GTTCATTACCAGCCATGAAGATGAC -3'

Sequencing Primer
(F):5'- GTACCGAGAATTTCCCTGAAT -3'
(R):5'- CAGCCATGAAGATGACATCATTTC -3'
Posted On2015-04-30