Incidental Mutation 'R4039:Prdm13'
ID313832
Institutional Source Beutler Lab
Gene Symbol Prdm13
Ensembl Gene ENSMUSG00000040478
Gene NamePR domain containing 13
Synonyms
MMRRC Submission 041614-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R4039 (G1)
Quality Score196
Status Validated
Chromosome4
Chromosomal Location21677480-21685963 bp(-) (GRCm38)
Type of Mutationutr 5 prime
DNA Base Change (assembly) T to G at 21685774 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000075562 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076206] [ENSMUST00000095141]
Predicted Effect probably benign
Transcript: ENSMUST00000076206
SMART Domains Protein: ENSMUSP00000075562
Gene: ENSMUSG00000040478

DomainStartEndE-ValueType
Blast:SET 2 118 4e-72 BLAST
PDB:3EP0|B 56 132 1e-8 PDB
ZnF_C2H2 137 159 3.34e-2 SMART
low complexity region 204 220 N/A INTRINSIC
low complexity region 231 252 N/A INTRINSIC
low complexity region 267 275 N/A INTRINSIC
low complexity region 302 335 N/A INTRINSIC
low complexity region 336 350 N/A INTRINSIC
low complexity region 353 370 N/A INTRINSIC
low complexity region 392 404 N/A INTRINSIC
low complexity region 546 571 N/A INTRINSIC
ZnF_C2H2 572 594 4.4e-2 SMART
ZnF_C2H2 600 622 1.92e-2 SMART
ZnF_C2H2 629 652 2.79e-4 SMART
Predicted Effect unknown
Transcript: ENSMUST00000095141
AA Change: T9P
SMART Domains Protein: ENSMUSP00000092761
Gene: ENSMUSG00000040478
AA Change: T9P

DomainStartEndE-ValueType
Blast:SET 42 166 1e-73 BLAST
PDB:3EP0|B 104 180 1e-8 PDB
ZnF_C2H2 185 207 3.34e-2 SMART
low complexity region 252 268 N/A INTRINSIC
low complexity region 279 300 N/A INTRINSIC
low complexity region 315 323 N/A INTRINSIC
low complexity region 350 383 N/A INTRINSIC
low complexity region 384 398 N/A INTRINSIC
low complexity region 401 418 N/A INTRINSIC
low complexity region 440 452 N/A INTRINSIC
low complexity region 594 619 N/A INTRINSIC
ZnF_C2H2 620 642 4.4e-2 SMART
ZnF_C2H2 648 670 1.92e-2 SMART
ZnF_C2H2 677 700 2.79e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139255
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144160
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149516
Meta Mutation Damage Score 0.068 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 98% (48/49)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele show a specific reduction in the number of GABAergic and glycinergic amacrine cells, a thin retinal inner nuclear layer, altered retinal inner plexiform layer morphology, and abnormally increased spatial, temporal, and contrast sensitivities in optokinetic reponses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933412E24Rik A T 15: 60,016,366 L75Q possibly damaging Het
Cep290 T C 10: 100,512,401 probably null Het
Col11a2 A G 17: 34,045,774 T268A probably benign Het
Crnkl1 T A 2: 145,932,327 D72V possibly damaging Het
Csn2 C T 5: 87,698,076 M1I probably null Het
Dhcr24 T C 4: 106,573,878 F255L probably benign Het
Epn2 A G 11: 61,546,522 Y75H probably damaging Het
Galnt3 A T 2: 66,085,327 H563Q probably damaging Het
Galnt9 T C 5: 110,614,208 V37A probably damaging Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Gorab A T 1: 163,397,066 D55E possibly damaging Het
Herc2 G A 7: 56,156,411 R2318Q probably damaging Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Hspb8 A G 5: 116,409,344 V193A probably benign Het
Ly75 A G 2: 60,352,995 L481P probably damaging Het
Lyzl1 T C 18: 4,169,140 L48P probably damaging Het
Mettl27 C T 5: 134,940,609 Q212* probably null Het
Mmachc T A 4: 116,706,018 T47S probably damaging Het
Ncam2 C T 16: 81,490,323 S375L probably benign Het
Ogfrl1 T C 1: 23,378,964 probably benign Het
Parp9 T C 16: 35,960,047 L461P probably damaging Het
Pcsk7 A G 9: 45,928,007 probably null Het
Plekhh1 C A 12: 79,055,183 H342Q probably benign Het
Prkaa2 T C 4: 105,051,247 N144D probably damaging Het
Ptpn12 A T 5: 21,002,510 Y283* probably null Het
Rab12 T C 17: 66,500,401 Y111C possibly damaging Het
Ralgapa1 T C 12: 55,795,701 N61S probably damaging Het
Rims1 T C 1: 22,475,712 S537G probably damaging Het
Sash1 G T 10: 8,729,627 P1000T probably damaging Het
Skint5 G T 4: 113,885,814 T352K unknown Het
Slc12a5 A G 2: 164,992,330 E757G probably benign Het
Sycp2 C A 2: 178,380,927 M470I possibly damaging Het
Szt2 T C 4: 118,364,952 probably benign Het
Tbc1d1 A G 5: 64,316,428 T765A probably damaging Het
Tgfbr2 T C 9: 116,175,037 M1V probably null Het
Tnfrsf11a A G 1: 105,827,739 probably null Het
Trim43b A G 9: 89,091,347 L111P probably damaging Het
Ttbk2 A T 2: 120,745,795 S900R probably benign Het
Unc79 G A 12: 103,074,949 C747Y possibly damaging Het
Vmn1r218 T C 13: 23,136,801 V26A possibly damaging Het
Vmn2r115 A T 17: 23,345,103 Y83F probably benign Het
Zfp536 A T 7: 37,569,550 L147Q probably damaging Het
Zfp931 T A 2: 178,067,984 Q203L possibly damaging Het
Zswim2 G A 2: 83,915,994 H367Y probably damaging Het
Other mutations in Prdm13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02940:Prdm13 APN 4 21683421 nonsense probably null
IGL03211:Prdm13 APN 4 21678492 missense probably damaging 1.00
R0363:Prdm13 UTSW 4 21679737 missense unknown
R0512:Prdm13 UTSW 4 21678490 missense probably damaging 1.00
R0726:Prdm13 UTSW 4 21683914 missense unknown
R1056:Prdm13 UTSW 4 21678544 missense probably damaging 1.00
R1433:Prdm13 UTSW 4 21678909 missense probably damaging 1.00
R2005:Prdm13 UTSW 4 21685695 utr 5 prime probably benign
R2292:Prdm13 UTSW 4 21683914 missense unknown
R2382:Prdm13 UTSW 4 21678277 missense possibly damaging 0.73
R3620:Prdm13 UTSW 4 21683532 missense unknown
R4417:Prdm13 UTSW 4 21678756 missense probably benign 0.39
R4453:Prdm13 UTSW 4 21679464 missense unknown
R4850:Prdm13 UTSW 4 21678243 missense possibly damaging 0.92
R4864:Prdm13 UTSW 4 21685543 missense unknown
R4934:Prdm13 UTSW 4 21678223 utr 3 prime probably benign
R5138:Prdm13 UTSW 4 21679507 missense unknown
R5304:Prdm13 UTSW 4 21678984 missense probably damaging 1.00
R5394:Prdm13 UTSW 4 21679455 missense unknown
R5909:Prdm13 UTSW 4 21683894 missense unknown
R5964:Prdm13 UTSW 4 21683852 nonsense probably null
R6261:Prdm13 UTSW 4 21678366 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTTGCCCAGCTTGAAGG -3'
(R):5'- CAGAGGCCTCGATTATGCAG -3'

Sequencing Primer
(F):5'- AGCTTGAAGGTGCCAGGC -3'
(R):5'- CTCGATTATGCAGGGGGC -3'
Posted On2015-04-30