Incidental Mutation 'R4039:Mmachc'
ID313836
Institutional Source Beutler Lab
Gene Symbol Mmachc
Ensembl Gene ENSMUSG00000028690
Gene Namemethylmalonic aciduria cblC type, with homocystinuria
Synonyms1810037K07Rik
MMRRC Submission 041614-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R4039 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location116702279-116708406 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 116706018 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 47 (T47S)
Ref Sequence ENSEMBL: ENSMUSP00000030453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030452] [ENSMUST00000030453] [ENSMUST00000106462] [ENSMUST00000106463] [ENSMUST00000106464] [ENSMUST00000125671] [ENSMUST00000130828] [ENSMUST00000135499] [ENSMUST00000138305] [ENSMUST00000155391]
Predicted Effect probably benign
Transcript: ENSMUST00000030452
SMART Domains Protein: ENSMUSP00000030452
Gene: ENSMUSG00000028689

DomainStartEndE-ValueType
coiled coil region 112 144 N/A INTRINSIC
coiled coil region 165 196 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000030453
AA Change: T47S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000030453
Gene: ENSMUSG00000028690
AA Change: T47S

DomainStartEndE-ValueType
Pfam:MMACHC 20 234 9.5e-102 PFAM
low complexity region 243 257 N/A INTRINSIC
low complexity region 268 277 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106462
SMART Domains Protein: ENSMUSP00000102070
Gene: ENSMUSG00000028689

DomainStartEndE-ValueType
coiled coil region 21 53 N/A INTRINSIC
coiled coil region 74 105 N/A INTRINSIC
low complexity region 171 186 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106463
SMART Domains Protein: ENSMUSP00000102071
Gene: ENSMUSG00000028689

DomainStartEndE-ValueType
low complexity region 50 60 N/A INTRINSIC
coiled coil region 138 170 N/A INTRINSIC
coiled coil region 191 222 N/A INTRINSIC
low complexity region 288 303 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106464
SMART Domains Protein: ENSMUSP00000102072
Gene: ENSMUSG00000028689

DomainStartEndE-ValueType
low complexity region 50 60 N/A INTRINSIC
coiled coil region 138 170 N/A INTRINSIC
coiled coil region 191 222 N/A INTRINSIC
low complexity region 288 303 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125671
SMART Domains Protein: ENSMUSP00000120954
Gene: ENSMUSG00000028689

DomainStartEndE-ValueType
low complexity region 50 60 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126197
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129624
Predicted Effect probably benign
Transcript: ENSMUST00000130828
SMART Domains Protein: ENSMUSP00000120572
Gene: ENSMUSG00000028689

DomainStartEndE-ValueType
low complexity region 49 59 N/A INTRINSIC
coiled coil region 137 169 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135499
SMART Domains Protein: ENSMUSP00000114263
Gene: ENSMUSG00000028689

DomainStartEndE-ValueType
low complexity region 63 73 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138305
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143330
Predicted Effect probably benign
Transcript: ENSMUST00000155391
SMART Domains Protein: ENSMUSP00000120050
Gene: ENSMUSG00000028689

DomainStartEndE-ValueType
low complexity region 49 59 N/A INTRINSIC
coiled coil region 137 169 N/A INTRINSIC
Meta Mutation Damage Score 0.078 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The exact function of the protein encoded by this gene is not known, however, its C-terminal region shows similarity to TonB, a bacterial protein involved in energy transduction for cobalamin (vitamin B12) uptake. Hence, it is postulated that this protein may have a role in the binding and intracellular trafficking of cobalamin. Mutations in this gene are associated with methylmalonic aciduria and homocystinuria type cblC. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933412E24Rik A T 15: 60,016,366 L75Q possibly damaging Het
Cep290 T C 10: 100,512,401 probably null Het
Col11a2 A G 17: 34,045,774 T268A probably benign Het
Crnkl1 T A 2: 145,932,327 D72V possibly damaging Het
Csn2 C T 5: 87,698,076 M1I probably null Het
Dhcr24 T C 4: 106,573,878 F255L probably benign Het
Epn2 A G 11: 61,546,522 Y75H probably damaging Het
Galnt3 A T 2: 66,085,327 H563Q probably damaging Het
Galnt9 T C 5: 110,614,208 V37A probably damaging Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Gorab A T 1: 163,397,066 D55E possibly damaging Het
Herc2 G A 7: 56,156,411 R2318Q probably damaging Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Hspb8 A G 5: 116,409,344 V193A probably benign Het
Ly75 A G 2: 60,352,995 L481P probably damaging Het
Lyzl1 T C 18: 4,169,140 L48P probably damaging Het
Mettl27 C T 5: 134,940,609 Q212* probably null Het
Ncam2 C T 16: 81,490,323 S375L probably benign Het
Ogfrl1 T C 1: 23,378,964 probably benign Het
Parp9 T C 16: 35,960,047 L461P probably damaging Het
Pcsk7 A G 9: 45,928,007 probably null Het
Plekhh1 C A 12: 79,055,183 H342Q probably benign Het
Prdm13 T G 4: 21,685,774 probably benign Het
Prkaa2 T C 4: 105,051,247 N144D probably damaging Het
Ptpn12 A T 5: 21,002,510 Y283* probably null Het
Rab12 T C 17: 66,500,401 Y111C possibly damaging Het
Ralgapa1 T C 12: 55,795,701 N61S probably damaging Het
Rims1 T C 1: 22,475,712 S537G probably damaging Het
Sash1 G T 10: 8,729,627 P1000T probably damaging Het
Skint5 G T 4: 113,885,814 T352K unknown Het
Slc12a5 A G 2: 164,992,330 E757G probably benign Het
Sycp2 C A 2: 178,380,927 M470I possibly damaging Het
Szt2 T C 4: 118,364,952 probably benign Het
Tbc1d1 A G 5: 64,316,428 T765A probably damaging Het
Tgfbr2 T C 9: 116,175,037 M1V probably null Het
Tnfrsf11a A G 1: 105,827,739 probably null Het
Trim43b A G 9: 89,091,347 L111P probably damaging Het
Ttbk2 A T 2: 120,745,795 S900R probably benign Het
Unc79 G A 12: 103,074,949 C747Y possibly damaging Het
Vmn1r218 T C 13: 23,136,801 V26A possibly damaging Het
Vmn2r115 A T 17: 23,345,103 Y83F probably benign Het
Zfp536 A T 7: 37,569,550 L147Q probably damaging Het
Zfp931 T A 2: 178,067,984 Q203L possibly damaging Het
Zswim2 G A 2: 83,915,994 H367Y probably damaging Het
Other mutations in Mmachc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Mmachc APN 4 116705921 missense probably damaging 1.00
IGL02014:Mmachc APN 4 116703710 missense probably damaging 1.00
R0242:Mmachc UTSW 4 116704541 missense probably damaging 0.97
R0242:Mmachc UTSW 4 116704541 missense probably damaging 0.97
R0646:Mmachc UTSW 4 116703654 missense probably damaging 1.00
R1413:Mmachc UTSW 4 116705997 missense probably damaging 0.97
R1589:Mmachc UTSW 4 116703524 missense probably benign 0.05
R4037:Mmachc UTSW 4 116706018 missense probably damaging 0.99
R4038:Mmachc UTSW 4 116706018 missense probably damaging 0.99
R4627:Mmachc UTSW 4 116703471 missense probably damaging 0.97
R5557:Mmachc UTSW 4 116705900 missense probably damaging 0.96
R6749:Mmachc UTSW 4 116704541 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCCTAAGCTAGGTCAACAG -3'
(R):5'- AGTTGATATGTAAGGCCAGGC -3'

Sequencing Primer
(F):5'- CCCTAAGCTAGGTCAACAGGGAAG -3'
(R):5'- AGCTTTCTGTGTTCCAGG -3'
Posted On2015-04-30