Incidental Mutation 'R4039:Hspb8'
ID313842
Institutional Source Beutler Lab
Gene Symbol Hspb8
Ensembl Gene ENSMUSG00000041548
Gene Nameheat shock protein 8
SynonymsH11K, E2IG1, HSP20-like, HSP22, Cryac, D5Ucla4, H11
MMRRC Submission 041614-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.231) question?
Stock #R4039 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location116408491-116422864 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116409344 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 193 (V193A)
Ref Sequence ENSEMBL: ENSMUSP00000037007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036991]
Predicted Effect probably benign
Transcript: ENSMUST00000036991
AA Change: V193A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000037007
Gene: ENSMUSG00000041548
AA Change: V193A

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
Pfam:HSP20 93 180 4e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133335
Meta Mutation Damage Score 0.076 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the superfamily of small heat-shock proteins containing a conservative alpha-crystallin domain at the C-terminal part of the molecule. The expression of this gene in induced by estrogen in estrogen receptor-positive breast cancer cells, and this protein also functions as a chaperone in association with Bag3, a stimulator of macroautophagy. Thus, this gene appears to be involved in regulation of cell proliferation, apoptosis, and carcinogenesis, and mutations in this gene have been associated with different neuromuscular diseases, including Charcot-Marie-Tooth disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: When exposed to pressure overload, mice homozygous for a knock-out allele develop less hypertrophy and display ventricular dilation, impaired contractile function, increased myocyte length and accumulation of interstitial collagen, accelerated transitioninto heart failure, and increased mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933412E24Rik A T 15: 60,016,366 L75Q possibly damaging Het
Cep290 T C 10: 100,512,401 probably null Het
Col11a2 A G 17: 34,045,774 T268A probably benign Het
Crnkl1 T A 2: 145,932,327 D72V possibly damaging Het
Csn2 C T 5: 87,698,076 M1I probably null Het
Dhcr24 T C 4: 106,573,878 F255L probably benign Het
Epn2 A G 11: 61,546,522 Y75H probably damaging Het
Galnt3 A T 2: 66,085,327 H563Q probably damaging Het
Galnt9 T C 5: 110,614,208 V37A probably damaging Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Gorab A T 1: 163,397,066 D55E possibly damaging Het
Herc2 G A 7: 56,156,411 R2318Q probably damaging Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Ly75 A G 2: 60,352,995 L481P probably damaging Het
Lyzl1 T C 18: 4,169,140 L48P probably damaging Het
Mettl27 C T 5: 134,940,609 Q212* probably null Het
Mmachc T A 4: 116,706,018 T47S probably damaging Het
Ncam2 C T 16: 81,490,323 S375L probably benign Het
Ogfrl1 T C 1: 23,378,964 probably benign Het
Parp9 T C 16: 35,960,047 L461P probably damaging Het
Pcsk7 A G 9: 45,928,007 probably null Het
Plekhh1 C A 12: 79,055,183 H342Q probably benign Het
Prdm13 T G 4: 21,685,774 probably benign Het
Prkaa2 T C 4: 105,051,247 N144D probably damaging Het
Ptpn12 A T 5: 21,002,510 Y283* probably null Het
Rab12 T C 17: 66,500,401 Y111C possibly damaging Het
Ralgapa1 T C 12: 55,795,701 N61S probably damaging Het
Rims1 T C 1: 22,475,712 S537G probably damaging Het
Sash1 G T 10: 8,729,627 P1000T probably damaging Het
Skint5 G T 4: 113,885,814 T352K unknown Het
Slc12a5 A G 2: 164,992,330 E757G probably benign Het
Sycp2 C A 2: 178,380,927 M470I possibly damaging Het
Szt2 T C 4: 118,364,952 probably benign Het
Tbc1d1 A G 5: 64,316,428 T765A probably damaging Het
Tgfbr2 T C 9: 116,175,037 M1V probably null Het
Tnfrsf11a A G 1: 105,827,739 probably null Het
Trim43b A G 9: 89,091,347 L111P probably damaging Het
Ttbk2 A T 2: 120,745,795 S900R probably benign Het
Unc79 G A 12: 103,074,949 C747Y possibly damaging Het
Vmn1r218 T C 13: 23,136,801 V26A possibly damaging Het
Vmn2r115 A T 17: 23,345,103 Y83F probably benign Het
Zfp536 A T 7: 37,569,550 L147Q probably damaging Het
Zfp931 T A 2: 178,067,984 Q203L possibly damaging Het
Zswim2 G A 2: 83,915,994 H367Y probably damaging Het
Other mutations in Hspb8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03308:Hspb8 APN 5 116409342 missense possibly damaging 0.86
R0332:Hspb8 UTSW 5 116409473 missense probably damaging 1.00
R4037:Hspb8 UTSW 5 116409344 missense probably benign 0.01
R5100:Hspb8 UTSW 5 116415409 missense probably damaging 1.00
R5256:Hspb8 UTSW 5 116409473 missense probably damaging 1.00
R6376:Hspb8 UTSW 5 116409432 missense probably damaging 1.00
R6476:Hspb8 UTSW 5 116422398 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTCACCCTGTGGAGAAATC -3'
(R):5'- TCAATGAACACGGTAGCTTTAGC -3'

Sequencing Primer
(F):5'- CGTCACCCTGTGGAGAAATCTATTAC -3'
(R):5'- ACAATCAGTGGTAAGACCTTCTG -3'
Posted On2015-04-30