Incidental Mutation 'R4039:Trim43b'
ID313850
Institutional Source Beutler Lab
Gene Symbol Trim43b
Ensembl Gene ENSMUSG00000079162
Gene Nametripartite motif-containing 43B
SynonymsGm8269
MMRRC Submission 041614-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R4039 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location89084624-89092835 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89091347 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 111 (L111P)
Ref Sequence ENSEMBL: ENSMUSP00000139457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167113] [ENSMUST00000189557]
Predicted Effect probably damaging
Transcript: ENSMUST00000167113
AA Change: L111P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126594
Gene: ENSMUSG00000079162
AA Change: L111P

DomainStartEndE-ValueType
RING 16 56 9.6e-7 SMART
Blast:BBOX 88 129 4e-8 BLAST
PDB:2VOK|B 329 445 3e-15 PDB
Blast:SPRY 336 441 9e-20 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000189557
AA Change: L111P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139457
Gene: ENSMUSG00000079162
AA Change: L111P

DomainStartEndE-ValueType
RING 16 56 4.7e-9 SMART
Blast:BBOX 88 129 4e-8 BLAST
SPRY 334 444 8.1e-5 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933412E24Rik A T 15: 60,016,366 L75Q possibly damaging Het
Cep290 T C 10: 100,512,401 probably null Het
Col11a2 A G 17: 34,045,774 T268A probably benign Het
Crnkl1 T A 2: 145,932,327 D72V possibly damaging Het
Csn2 C T 5: 87,698,076 M1I probably null Het
Dhcr24 T C 4: 106,573,878 F255L probably benign Het
Epn2 A G 11: 61,546,522 Y75H probably damaging Het
Galnt3 A T 2: 66,085,327 H563Q probably damaging Het
Galnt9 T C 5: 110,614,208 V37A probably damaging Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Gorab A T 1: 163,397,066 D55E possibly damaging Het
Herc2 G A 7: 56,156,411 R2318Q probably damaging Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Hspb8 A G 5: 116,409,344 V193A probably benign Het
Ly75 A G 2: 60,352,995 L481P probably damaging Het
Lyzl1 T C 18: 4,169,140 L48P probably damaging Het
Mettl27 C T 5: 134,940,609 Q212* probably null Het
Mmachc T A 4: 116,706,018 T47S probably damaging Het
Ncam2 C T 16: 81,490,323 S375L probably benign Het
Ogfrl1 T C 1: 23,378,964 probably benign Het
Parp9 T C 16: 35,960,047 L461P probably damaging Het
Pcsk7 A G 9: 45,928,007 probably null Het
Plekhh1 C A 12: 79,055,183 H342Q probably benign Het
Prdm13 T G 4: 21,685,774 probably benign Het
Prkaa2 T C 4: 105,051,247 N144D probably damaging Het
Ptpn12 A T 5: 21,002,510 Y283* probably null Het
Rab12 T C 17: 66,500,401 Y111C possibly damaging Het
Ralgapa1 T C 12: 55,795,701 N61S probably damaging Het
Rims1 T C 1: 22,475,712 S537G probably damaging Het
Sash1 G T 10: 8,729,627 P1000T probably damaging Het
Skint5 G T 4: 113,885,814 T352K unknown Het
Slc12a5 A G 2: 164,992,330 E757G probably benign Het
Sycp2 C A 2: 178,380,927 M470I possibly damaging Het
Szt2 T C 4: 118,364,952 probably benign Het
Tbc1d1 A G 5: 64,316,428 T765A probably damaging Het
Tgfbr2 T C 9: 116,175,037 M1V probably null Het
Tnfrsf11a A G 1: 105,827,739 probably null Het
Ttbk2 A T 2: 120,745,795 S900R probably benign Het
Unc79 G A 12: 103,074,949 C747Y possibly damaging Het
Vmn1r218 T C 13: 23,136,801 V26A possibly damaging Het
Vmn2r115 A T 17: 23,345,103 Y83F probably benign Het
Zfp536 A T 7: 37,569,550 L147Q probably damaging Het
Zfp931 T A 2: 178,067,984 Q203L possibly damaging Het
Zswim2 G A 2: 83,915,994 H367Y probably damaging Het
Other mutations in Trim43b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Trim43b APN 9 89091642 missense probably benign 0.04
IGL01953:Trim43b APN 9 89085443 missense possibly damaging 0.74
IGL02160:Trim43b APN 9 89091630 missense probably benign 0.35
IGL02626:Trim43b APN 9 89085488 missense possibly damaging 0.89
IGL03199:Trim43b APN 9 89089428 missense probably damaging 0.98
R0477:Trim43b UTSW 9 89090601 missense probably damaging 1.00
R1345:Trim43b UTSW 9 89085672 missense possibly damaging 0.77
R1491:Trim43b UTSW 9 89087612 missense possibly damaging 0.52
R1536:Trim43b UTSW 9 89085358 nonsense probably null
R1862:Trim43b UTSW 9 89085571 missense probably damaging 1.00
R2211:Trim43b UTSW 9 89085249 missense possibly damaging 0.91
R4222:Trim43b UTSW 9 89090639 missense probably benign 0.00
R4223:Trim43b UTSW 9 89090639 missense probably benign 0.00
R4224:Trim43b UTSW 9 89090639 missense probably benign 0.00
R4726:Trim43b UTSW 9 89089485 missense possibly damaging 0.70
R4812:Trim43b UTSW 9 89091480 missense probably benign 0.05
R4887:Trim43b UTSW 9 89091312 missense probably damaging 0.99
R5865:Trim43b UTSW 9 89085606 missense probably benign 0.19
R5909:Trim43b UTSW 9 89085398 missense possibly damaging 0.94
R6226:Trim43b UTSW 9 89091275 missense possibly damaging 0.82
R6378:Trim43b UTSW 9 89085399 missense probably benign 0.08
R6531:Trim43b UTSW 9 89085365 missense probably damaging 1.00
V5622:Trim43b UTSW 9 89092545 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CAATGACTTCATCCGAATCAGG -3'
(R):5'- CTGCGAGGCATGTCTCTTAC -3'

Sequencing Primer
(F):5'- GAATCAGGATAAGCATCTTCCTGTGG -3'
(R):5'- GAAGACATCAAATTTCCTGCCTACTG -3'
Posted On2015-04-30