Mutagenetix > Incidental Mutations

Incidental Mutation 'R4039:Tgfbr2'

313851

Institutional Source

Beutler Lab

Gene Symbol

Tgfbr2

Ensembl Gene

ENSMUSG00000032440

Gene Name

transforming growth factor, beta receptor II

Synonyms

TbetaR-II, TBR-II, TbetaRII, 1110020H15Rik

MMRRC Submission

041614-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4039 (G1)

Quality Score

122

Status

Validated

Chromosome

Chromosomal Location

116084293-116175360 bp(-) (GRCm38)

Type of Mutation

start codon destroyed

DNA Base Change (assembly)

T to C at 116175037 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 1 (M1V)

Ref Sequence

ENSEMBL: ENSMUSP00000062333 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035014] [ENSMUST00000061101]

Predicted Effect

probably null
Transcript: ENSMUST00000035014
AA Change: M1V

PolyPhen 2 Score 0.619 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000035014
Gene: ENSMUSG00000032440
AA Change: M1V

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:ecTbetaR2	47	165	1.8e-55	PFAM
Pfam:Pkinase	244	538	9.9e-52	PFAM
Pfam:Pkinase_Tyr	244	538	2.9e-37	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000061101
AA Change: M1V

PolyPhen 2 Score 0.619 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000062333
Gene: ENSMUSG00000032440
AA Change: M1V

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:ecTbetaR2	74	184	4.6e-45	PFAM
transmembrane domain	189	211	N/A	INTRINSIC
Pfam:Pkinase	269	563	2.7e-36	PFAM
Pfam:Pkinase_Tyr	269	563	5e-37	PFAM

Meta Mutation Damage Score

0.478

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.0%

Validation Efficiency

98% (48/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ser/Thr protein kinase family and the TGFB receptor subfamily. The encoded protein is a transmembrane protein that has a protein kinase domain, forms a heterodimeric complex with another receptor protein, and binds TGF-beta. This receptor/ligand complex phosphorylates proteins, which then enter the nucleus and regulate the transcription of a subset of genes related to cell proliferation. Mutations in this gene have been associated with Marfan Syndrome, Loeys-Deitz Aortic Aneurysm Syndrome, and the development of various types of tumors. Alternatively spliced transcript variants encoding different isoforms have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die in midgestation with impaired yolk sac hematopoiesis and vasculogenesis. Selective knockouts in bone marrow cells and cranial neural crest show inflammation and cleft palate/calvarial defects, respectively. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933412E24Rik	A	T	15: 60,016,366	L75Q	possibly damaging	Het
Cep290	T	C	10: 100,512,401		probably null	Het
Col11a2	A	G	17: 34,045,774	T268A	probably benign	Het
Crnkl1	T	A	2: 145,932,327	D72V	possibly damaging	Het
Csn2	C	T	5: 87,698,076	M1I	probably null	Het
Dhcr24	T	C	4: 106,573,878	F255L	probably benign	Het
Epn2	A	G	11: 61,546,522	Y75H	probably damaging	Het
Galnt3	A	T	2: 66,085,327	H563Q	probably damaging	Het
Galnt9	T	C	5: 110,614,208	V37A	probably damaging	Het
Glb1l3	A	C	9: 26,829,047	M329R	probably damaging	Het
Gorab	A	T	1: 163,397,066	D55E	possibly damaging	Het
Herc2	G	A	7: 56,156,411	R2318Q	probably damaging	Het
Hspa2	T	C	12: 76,405,768	V412A	probably damaging	Het
Hspb8	A	G	5: 116,409,344	V193A	probably benign	Het
Ly75	A	G	2: 60,352,995	L481P	probably damaging	Het
Lyzl1	T	C	18: 4,169,140	L48P	probably damaging	Het
Mettl27	C	T	5: 134,940,609	Q212*	probably null	Het
Mmachc	T	A	4: 116,706,018	T47S	probably damaging	Het
Ncam2	C	T	16: 81,490,323	S375L	probably benign	Het
Ogfrl1	T	C	1: 23,378,964		probably benign	Het
Parp9	T	C	16: 35,960,047	L461P	probably damaging	Het
Pcsk7	A	G	9: 45,928,007		probably null	Het
Plekhh1	C	A	12: 79,055,183	H342Q	probably benign	Het
Prdm13	T	G	4: 21,685,774		probably benign	Het
Prkaa2	T	C	4: 105,051,247	N144D	probably damaging	Het
Ptpn12	A	T	5: 21,002,510	Y283*	probably null	Het
Rab12	T	C	17: 66,500,401	Y111C	possibly damaging	Het
Ralgapa1	T	C	12: 55,795,701	N61S	probably damaging	Het
Rims1	T	C	1: 22,475,712	S537G	probably damaging	Het
Sash1	G	T	10: 8,729,627	P1000T	probably damaging	Het
Skint5	G	T	4: 113,885,814	T352K	unknown	Het
Slc12a5	A	G	2: 164,992,330	E757G	probably benign	Het
Sycp2	C	A	2: 178,380,927	M470I	possibly damaging	Het
Szt2	T	C	4: 118,364,952		probably benign	Het
Tbc1d1	A	G	5: 64,316,428	T765A	probably damaging	Het
Tnfrsf11a	A	G	1: 105,827,739		probably null	Het
Trim43b	A	G	9: 89,091,347	L111P	probably damaging	Het
Ttbk2	A	T	2: 120,745,795	S900R	probably benign	Het
Unc79	G	A	12: 103,074,949	C747Y	possibly damaging	Het
Vmn1r218	T	C	13: 23,136,801	V26A	possibly damaging	Het
Vmn2r115	A	T	17: 23,345,103	Y83F	probably benign	Het
Zfp536	A	T	7: 37,569,550	L147Q	probably damaging	Het
Zfp931	T	A	2: 178,067,984	Q203L	possibly damaging	Het
Zswim2	G	A	2: 83,915,994	H367Y	probably damaging	Het

Other mutations in Tgfbr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Tgfbr2	APN	9	116110189	missense	probably damaging	0.99
IGL00484:Tgfbr2	APN	9	116158289	missense	probably benign	0.00
IGL01010:Tgfbr2	APN	9	116129980	missense	possibly damaging	0.80
IGL01656:Tgfbr2	APN	9	116109669	missense	probably damaging	1.00
IGL02496:Tgfbr2	APN	9	116090418	missense	probably benign	0.13
IGL02550:Tgfbr2	APN	9	116110129	missense	probably benign
IGL02563:Tgfbr2	APN	9	116129998	missense	probably benign	0.10
IGL03403:Tgfbr2	APN	9	116110302	missense	probably benign
IGL02799:Tgfbr2	UTSW	9	116110136	missense	possibly damaging	0.50
R0617:Tgfbr2	UTSW	9	116158320	missense	probably benign	0.00
R1483:Tgfbr2	UTSW	9	116109557	missense	probably benign	0.04
R1776:Tgfbr2	UTSW	9	116174967	missense	possibly damaging	0.94
R1777:Tgfbr2	UTSW	9	116109880	missense	probably damaging	0.99
R1831:Tgfbr2	UTSW	9	116090536	missense	possibly damaging	0.74
R2323:Tgfbr2	UTSW	9	116110144	missense	possibly damaging	0.90
R2378:Tgfbr2	UTSW	9	116129950	missense	probably benign	0.02
R3123:Tgfbr2	UTSW	9	116110069	missense	possibly damaging	0.95
R3418:Tgfbr2	UTSW	9	116129833	missense	probably damaging	1.00
R3605:Tgfbr2	UTSW	9	116109892	missense	probably benign	0.03
R4191:Tgfbr2	UTSW	9	116109941	missense	probably damaging	1.00
R4193:Tgfbr2	UTSW	9	116109941	missense	probably damaging	1.00
R4945:Tgfbr2	UTSW	9	116131565	missense	probably benign
R5431:Tgfbr2	UTSW	9	116131601	missense	probably damaging	0.99
R5714:Tgfbr2	UTSW	9	116175024	missense	probably damaging	0.98
R5964:Tgfbr2	UTSW	9	116110255	missense	possibly damaging	0.64
R6180:Tgfbr2	UTSW	9	116110144	missense	possibly damaging	0.90
R6970:Tgfbr2	UTSW	9	116110051	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TCCTGCTCTTTTGCGAGAGATC -3'
(R):5'- CCCGGGTAAAGTTGATGAGTG -3'

Sequencing Primer
(F):5'- TCGGGCCGCTACAAACTTC -3'
(R):5'- AGTGAGTCACTCGCGCG -3'

Posted On

2015-04-30