Incidental Mutation 'R4039:Plekhh1'
ID313858
Institutional Source Beutler Lab
Gene Symbol Plekhh1
Ensembl Gene ENSMUSG00000060716
Gene Namepleckstrin homology domain containing, family H (with MyTH4 domain) member 1
Synonyms
MMRRC Submission 041614-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.389) question?
Stock #R4039 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location79029163-79081655 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 79055183 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 342 (H342Q)
Ref Sequence ENSEMBL: ENSMUSP00000151747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039928] [ENSMUST00000217954] [ENSMUST00000219956]
Predicted Effect probably benign
Transcript: ENSMUST00000039928
AA Change: H342Q

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000049460
Gene: ENSMUSG00000060716
AA Change: H342Q

DomainStartEndE-ValueType
coiled coil region 26 172 N/A INTRINSIC
low complexity region 363 379 N/A INTRINSIC
low complexity region 489 500 N/A INTRINSIC
PH 573 668 1.15e-22 SMART
PH 682 792 3.23e-8 SMART
MyTH4 826 980 3e-48 SMART
B41 987 1224 6.07e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000217954
Predicted Effect probably benign
Transcript: ENSMUST00000219956
AA Change: H342Q

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Meta Mutation Damage Score 0.1116 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933412E24Rik A T 15: 60,016,366 L75Q possibly damaging Het
Cep290 T C 10: 100,512,401 probably null Het
Col11a2 A G 17: 34,045,774 T268A probably benign Het
Crnkl1 T A 2: 145,932,327 D72V possibly damaging Het
Csn2 C T 5: 87,698,076 M1I probably null Het
Dhcr24 T C 4: 106,573,878 F255L probably benign Het
Epn2 A G 11: 61,546,522 Y75H probably damaging Het
Galnt3 A T 2: 66,085,327 H563Q probably damaging Het
Galnt9 T C 5: 110,614,208 V37A probably damaging Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Gorab A T 1: 163,397,066 D55E possibly damaging Het
Herc2 G A 7: 56,156,411 R2318Q probably damaging Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Hspb8 A G 5: 116,409,344 V193A probably benign Het
Ly75 A G 2: 60,352,995 L481P probably damaging Het
Lyzl1 T C 18: 4,169,140 L48P probably damaging Het
Mettl27 C T 5: 134,940,609 Q212* probably null Het
Mmachc T A 4: 116,706,018 T47S probably damaging Het
Ncam2 C T 16: 81,490,323 S375L probably benign Het
Ogfrl1 T C 1: 23,378,964 probably benign Het
Parp9 T C 16: 35,960,047 L461P probably damaging Het
Pcsk7 A G 9: 45,928,007 probably null Het
Prdm13 T G 4: 21,685,774 probably benign Het
Prkaa2 T C 4: 105,051,247 N144D probably damaging Het
Ptpn12 A T 5: 21,002,510 Y283* probably null Het
Rab12 T C 17: 66,500,401 Y111C possibly damaging Het
Ralgapa1 T C 12: 55,795,701 N61S probably damaging Het
Rims1 T C 1: 22,475,712 S537G probably damaging Het
Sash1 G T 10: 8,729,627 P1000T probably damaging Het
Skint5 G T 4: 113,885,814 T352K unknown Het
Slc12a5 A G 2: 164,992,330 E757G probably benign Het
Sycp2 C A 2: 178,380,927 M470I possibly damaging Het
Szt2 T C 4: 118,364,952 probably benign Het
Tbc1d1 A G 5: 64,316,428 T765A probably damaging Het
Tgfbr2 T C 9: 116,175,037 M1V probably null Het
Tnfrsf11a A G 1: 105,827,739 probably null Het
Trim43b A G 9: 89,091,347 L111P probably damaging Het
Ttbk2 A T 2: 120,745,795 S900R probably benign Het
Unc79 G A 12: 103,074,949 C747Y possibly damaging Het
Vmn1r218 T C 13: 23,136,801 V26A possibly damaging Het
Vmn2r115 A T 17: 23,345,103 Y83F probably benign Het
Zfp536 A T 7: 37,569,550 L147Q probably damaging Het
Zfp931 T A 2: 178,067,984 Q203L possibly damaging Het
Zswim2 G A 2: 83,915,994 H367Y probably damaging Het
Other mutations in Plekhh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01707:Plekhh1 APN 12 79078964 missense probably benign 0.35
IGL01764:Plekhh1 APN 12 79054905 missense probably benign 0.00
IGL01922:Plekhh1 APN 12 79079579 missense probably benign
IGL02187:Plekhh1 APN 12 79072818 missense probably damaging 1.00
IGL02406:Plekhh1 APN 12 79069009 splice site probably benign
IGL02581:Plekhh1 APN 12 79079108 critical splice donor site probably null
IGL03201:Plekhh1 APN 12 79053656 missense probably damaging 1.00
R0088:Plekhh1 UTSW 12 79055366 missense probably benign 0.00
R0626:Plekhh1 UTSW 12 79040585 nonsense probably null
R0662:Plekhh1 UTSW 12 79078993 missense probably benign 0.09
R0666:Plekhh1 UTSW 12 79069115 missense probably damaging 0.99
R0966:Plekhh1 UTSW 12 79065730 missense probably damaging 1.00
R1027:Plekhh1 UTSW 12 79054482 splice site probably benign
R1507:Plekhh1 UTSW 12 79079450 missense probably damaging 1.00
R1562:Plekhh1 UTSW 12 79076708 missense probably benign 0.00
R1759:Plekhh1 UTSW 12 79072761 missense probably damaging 1.00
R1839:Plekhh1 UTSW 12 79078957 splice site probably benign
R2125:Plekhh1 UTSW 12 79079000 missense probably damaging 1.00
R2345:Plekhh1 UTSW 12 79053647 missense probably damaging 1.00
R3895:Plekhh1 UTSW 12 79055232 missense probably benign
R3927:Plekhh1 UTSW 12 79053648 missense probably damaging 1.00
R4720:Plekhh1 UTSW 12 79075420 frame shift probably null
R4721:Plekhh1 UTSW 12 79075420 frame shift probably null
R4824:Plekhh1 UTSW 12 79054803 missense probably benign
R4869:Plekhh1 UTSW 12 79050386 missense probably benign
R5114:Plekhh1 UTSW 12 79069106 missense probably benign 0.00
R5809:Plekhh1 UTSW 12 79078687 missense probably benign 0.26
R6540:Plekhh1 UTSW 12 79064489 missense probably benign 0.14
R6977:Plekhh1 UTSW 12 79065717 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGTCTGGTCACTGCTCAGG -3'
(R):5'- AGATGGAAACCTGTGCAGTG -3'

Sequencing Primer
(F):5'- ACTGCTCAGGGAGGGACATTC -3'
(R):5'- AGGTGGCTTGTTCTCCAGTTCC -3'
Posted On2015-04-30