Incidental Mutation 'R4043:Dlgap1'
ID313961
Institutional Source Beutler Lab
Gene Symbol Dlgap1
Ensembl Gene ENSMUSG00000003279
Gene NameDLG associated protein 1
SynonymsGKAP/SAPAP, 4933422O14Rik, SAPAP1, Gkap, Sapap1, D17Bwg0511e, DAP-1 beta
MMRRC Submission 041615-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4043 (G1)
Quality Score207
Status Validated
Chromosome17
Chromosomal Location69969073-70821413 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70761080 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 549 (S549P)
Ref Sequence ENSEMBL: ENSMUSP00000122896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060072] [ENSMUST00000097288] [ENSMUST00000133717] [ENSMUST00000133983] [ENSMUST00000135938] [ENSMUST00000140728] [ENSMUST00000146730] [ENSMUST00000148486] [ENSMUST00000155016]
Predicted Effect probably damaging
Transcript: ENSMUST00000060072
AA Change: S539P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052858
Gene: ENSMUSG00000003279
AA Change: S539P

DomainStartEndE-ValueType
low complexity region 180 210 N/A INTRINSIC
low complexity region 515 539 N/A INTRINSIC
low complexity region 542 559 N/A INTRINSIC
low complexity region 628 642 N/A INTRINSIC
Pfam:GKAP 643 982 6.8e-139 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000097288
AA Change: S241P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000094890
Gene: ENSMUSG00000003279
AA Change: S241P

DomainStartEndE-ValueType
low complexity region 208 228 N/A INTRINSIC
low complexity region 244 261 N/A INTRINSIC
low complexity region 330 344 N/A INTRINSIC
Pfam:GKAP 345 625 9.4e-106 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126801
Predicted Effect probably benign
Transcript: ENSMUST00000133717
SMART Domains Protein: ENSMUSP00000122370
Gene: ENSMUSG00000003279

DomainStartEndE-ValueType
low complexity region 218 238 N/A INTRINSIC
low complexity region 312 326 N/A INTRINSIC
Pfam:GKAP 327 666 1.3e-139 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000133983
AA Change: S539P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116716
Gene: ENSMUSG00000003279
AA Change: S539P

DomainStartEndE-ValueType
low complexity region 180 210 N/A INTRINSIC
low complexity region 515 539 N/A INTRINSIC
low complexity region 542 559 N/A INTRINSIC
low complexity region 628 642 N/A INTRINSIC
Pfam:GKAP 643 982 6.8e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135938
SMART Domains Protein: ENSMUSP00000118497
Gene: ENSMUSG00000003279

DomainStartEndE-ValueType
low complexity region 180 210 N/A INTRINSIC
low complexity region 516 536 N/A INTRINSIC
low complexity region 610 624 N/A INTRINSIC
Pfam:GKAP 625 964 9.3e-139 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000140728
AA Change: S249P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117358
Gene: ENSMUSG00000003279
AA Change: S249P

DomainStartEndE-ValueType
low complexity region 216 236 N/A INTRINSIC
low complexity region 252 269 N/A INTRINSIC
low complexity region 338 352 N/A INTRINSIC
Pfam:GKAP 353 692 1.4e-139 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000146730
AA Change: S549P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116072
Gene: ENSMUSG00000003279
AA Change: S549P

DomainStartEndE-ValueType
low complexity region 180 210 N/A INTRINSIC
low complexity region 516 536 N/A INTRINSIC
low complexity region 552 569 N/A INTRINSIC
low complexity region 638 652 N/A INTRINSIC
Pfam:GKAP 653 933 9.5e-106 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000148486
AA Change: S239P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122337
Gene: ENSMUSG00000003279
AA Change: S239P

DomainStartEndE-ValueType
low complexity region 215 239 N/A INTRINSIC
low complexity region 242 259 N/A INTRINSIC
low complexity region 328 342 N/A INTRINSIC
Pfam:GKAP 343 682 1.3e-139 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000155016
AA Change: S549P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122896
Gene: ENSMUSG00000003279
AA Change: S549P

DomainStartEndE-ValueType
low complexity region 180 210 N/A INTRINSIC
low complexity region 516 536 N/A INTRINSIC
low complexity region 552 569 N/A INTRINSIC
low complexity region 638 652 N/A INTRINSIC
Pfam:GKAP 660 992 2e-153 PFAM
Meta Mutation Damage Score 0.238 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 92.9%
Validation Efficiency 97% (64/66)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik A T 19: 28,945,783 C80S possibly damaging Het
4930415L06Rik A G X: 89,932,303 F96S probably damaging Het
Adgrf3 T C 5: 30,204,362 N44D probably benign Het
AU018091 A G 7: 3,159,122 F375L probably damaging Het
Bsph1 G T 7: 13,458,276 probably null Het
Casp1 A G 9: 5,302,444 D122G probably benign Het
Ccdc146 C T 5: 21,316,943 C361Y probably benign Het
Cdc37l1 T C 19: 28,990,628 S31P possibly damaging Het
Cdca2 A T 14: 67,704,006 M249K probably benign Het
Cfap73 C T 5: 120,629,965 probably null Het
Cgnl1 A G 9: 71,705,293 L749S probably damaging Het
Cmtr2 C A 8: 110,221,830 C257* probably null Het
Col6a4 A T 9: 106,072,411 L675* probably null Het
Cpne8 A T 15: 90,572,001 D186E probably damaging Het
Csmd3 A G 15: 47,755,966 probably null Het
D330045A20Rik C T X: 139,507,003 S364L probably damaging Het
D430042O09Rik A G 7: 125,868,741 I1366V probably benign Het
Daglb T A 5: 143,487,151 Y354N possibly damaging Het
Dnah11 T C 12: 117,879,943 D4389G probably damaging Het
Dst T A 1: 34,190,684 C2631S probably benign Het
Gimap1 T A 6: 48,743,242 W263R probably damaging Het
Gne A C 4: 44,040,383 C594G possibly damaging Het
Gtf2a1 T C 12: 91,575,667 H47R probably benign Het
Hdac6 T C X: 7,931,492 T993A probably benign Het
Helz2 T C 2: 181,229,710 D2703G probably benign Het
Jmjd1c G A 10: 67,219,466 V222I possibly damaging Het
Kndc1 A G 7: 139,924,129 E1116G probably benign Het
Krt10 C T 11: 99,386,993 probably null Het
Lrrc37a T G 11: 103,498,653 H1982P possibly damaging Het
Med13l T A 5: 118,593,463 L68Q probably damaging Het
Megf10 C A 18: 57,259,798 D422E probably damaging Het
Mpz C T 1: 171,159,771 probably benign Het
Muc5ac A T 7: 141,807,478 T1508S possibly damaging Het
Myo3a C T 2: 22,333,539 probably benign Het
Ndnf A T 6: 65,703,936 N400Y possibly damaging Het
Olfr192 G A 16: 59,098,761 T77I unknown Het
Olfr414 T C 1: 174,431,091 I221T probably damaging Het
Olfr855 G T 9: 19,584,995 V153F probably benign Het
Otol1 A G 3: 70,027,779 D368G probably damaging Het
Pappa A G 4: 65,314,587 N1321S probably benign Het
Patl1 T A 19: 11,942,950 L756Q probably damaging Het
Plcg2 A G 8: 117,612,978 M1043V probably benign Het
Plekhg2 G A 7: 28,364,719 probably benign Het
Ppp2r2d G A 7: 138,882,416 W265* probably null Het
Prss40 G T 1: 34,560,879 S9* probably null Het
Radil T A 5: 142,494,233 I471F probably benign Het
Rpl10l A T 12: 66,284,203 M52K probably damaging Het
Scn1a A T 2: 66,326,036 S510T possibly damaging Het
Sdad1 T G 5: 92,302,694 N194T probably damaging Het
Sel1l3 A T 5: 53,188,054 Y259* probably null Het
Slc22a26 T C 19: 7,788,329 probably null Het
Snap91 C T 9: 86,777,049 G477D probably damaging Het
Srr T C 11: 74,909,121 T202A probably benign Het
Srrm1 C T 4: 135,340,931 probably benign Het
Trp53bp2 T A 1: 182,449,061 L869Q possibly damaging Het
Ttbk1 T A 17: 46,446,762 D982V probably benign Het
Ttn T C 2: 76,794,157 T15324A probably benign Het
Ush1c T C 7: 46,221,528 E276G probably damaging Het
Vcan T A 13: 89,692,543 L1627F probably benign Het
Vps8 A C 16: 21,526,396 D823A probably damaging Het
Zfp616 T A 11: 74,085,282 N792K possibly damaging Het
Zfpm2 A T 15: 40,870,627 D2V possibly damaging Het
Zfyve16 A C 13: 92,513,763 probably null Het
Zmym2 T A 14: 56,958,308 probably benign Het
Other mutations in Dlgap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Dlgap1 APN 17 70516085 missense probably benign 0.02
IGL01413:Dlgap1 APN 17 70516074 missense probably benign 0.00
IGL01531:Dlgap1 APN 17 70516379 missense probably damaging 1.00
IGL02226:Dlgap1 APN 17 70516034 missense probably damaging 1.00
R0453:Dlgap1 UTSW 17 70761346 missense probably benign 0.03
R0482:Dlgap1 UTSW 17 70516190 missense probably benign 0.11
R0520:Dlgap1 UTSW 17 70516994 nonsense probably null
R1951:Dlgap1 UTSW 17 70761311 missense probably damaging 0.96
R2072:Dlgap1 UTSW 17 70662770 missense probably damaging 0.99
R2076:Dlgap1 UTSW 17 70786831 nonsense probably null
R3438:Dlgap1 UTSW 17 70516361 missense probably damaging 0.97
R3743:Dlgap1 UTSW 17 70718226 critical splice donor site probably null
R3881:Dlgap1 UTSW 17 70786815 missense probably damaging 1.00
R3981:Dlgap1 UTSW 17 70516785 missense probably damaging 1.00
R4272:Dlgap1 UTSW 17 70766043 missense probably benign
R4273:Dlgap1 UTSW 17 70766043 missense probably benign
R4557:Dlgap1 UTSW 17 70516689 missense probably benign 0.01
R4652:Dlgap1 UTSW 17 70761095 missense probably damaging 1.00
R4771:Dlgap1 UTSW 17 70593380 nonsense probably null
R5000:Dlgap1 UTSW 17 70766058 missense probably damaging 1.00
R5004:Dlgap1 UTSW 17 70718227 critical splice donor site probably null
R5291:Dlgap1 UTSW 17 70718210 missense probably benign 0.03
R5304:Dlgap1 UTSW 17 70815207 missense probably damaging 1.00
R5473:Dlgap1 UTSW 17 70517030 intron probably benign
R5522:Dlgap1 UTSW 17 70516998 critical splice donor site probably null
R5586:Dlgap1 UTSW 17 70818161 missense probably damaging 1.00
R5742:Dlgap1 UTSW 17 70718199 missense probably benign
R5802:Dlgap1 UTSW 17 70766091 critical splice donor site probably null
R5850:Dlgap1 UTSW 17 70787092 missense probably damaging 1.00
R5857:Dlgap1 UTSW 17 70815393 intron probably benign
R5883:Dlgap1 UTSW 17 70517013 intron probably benign
R6045:Dlgap1 UTSW 17 70818098 missense probably damaging 1.00
R6336:Dlgap1 UTSW 17 70815289 missense probably damaging 1.00
R6448:Dlgap1 UTSW 17 70593330 missense possibly damaging 0.59
R6682:Dlgap1 UTSW 17 70787123 missense probably damaging 1.00
R6795:Dlgap1 UTSW 17 70818074 missense possibly damaging 0.48
R7147:Dlgap1 UTSW 17 70662758 missense probably benign 0.00
R7187:Dlgap1 UTSW 17 70516098 missense possibly damaging 0.93
R7382:Dlgap1 UTSW 17 70787174 missense probably damaging 1.00
T0975:Dlgap1 UTSW 17 70516955 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- ATAGCTTCCGTTTCAGAGGTG -3'
(R):5'- CCAGACTTTCGGTGGAGTTG -3'

Sequencing Primer
(F):5'- AGGTGGGTGTCCTCCAATCTC -3'
(R):5'- AGTTGCTGAGGCCAGACTG -3'
Posted On2015-04-30