Incidental Mutation 'R4044:Nell1'
ID 313983
Institutional Source Beutler Lab
Gene Symbol Nell1
Ensembl Gene ENSMUSG00000055409
Gene Name NEL-like 1
Synonyms l7R6, B230343H07Rik
MMRRC Submission 040967-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4044 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 49625098-50513037 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 49869367 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 214 (N214S)
Ref Sequence ENSEMBL: ENSMUSP00000114706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081872] [ENSMUST00000107603] [ENSMUST00000151721]
AlphaFold Q2VWQ2
Predicted Effect possibly damaging
Transcript: ENSMUST00000081872
AA Change: N214S

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000080550
Gene: ENSMUSG00000055409
AA Change: N214S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TSPN 29 213 8.5e-72 SMART
LamG 81 208 1.77e-14 SMART
coiled coil region 240 266 N/A INTRINSIC
VWC 273 331 1.45e-6 SMART
VWC 335 389 1.34e0 SMART
EGF 394 433 1.06e0 SMART
EGF_CA 434 475 7.93e-9 SMART
EGF 479 516 1.1e-2 SMART
EGF 518 547 8.32e-3 SMART
EGF_CA 549 595 1.08e-10 SMART
EGF_like 596 635 1.84e-4 SMART
VWC 634 686 1.42e0 SMART
VWC 694 749 1.83e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107603
AA Change: N214S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000103229
Gene: ENSMUSG00000055409
AA Change: N214S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TSPN 29 213 8.5e-72 SMART
LamG 81 208 1.77e-14 SMART
coiled coil region 240 266 N/A INTRINSIC
VWC 273 331 1.45e-6 SMART
VWC 335 389 1.34e0 SMART
EGF 394 433 1.06e0 SMART
EGF_CA 434 475 7.93e-9 SMART
EGF 479 516 1.1e-2 SMART
EGF 518 547 8.32e-3 SMART
EGF_like 549 588 1.84e-4 SMART
VWC 587 639 1.42e0 SMART
VWC 647 702 1.83e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145096
Predicted Effect probably damaging
Transcript: ENSMUST00000151721
AA Change: N214S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114706
Gene: ENSMUSG00000055409
AA Change: N214S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TSPN 29 213 8.5e-72 SMART
LamG 81 208 1.77e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154410
Meta Mutation Damage Score 0.2016 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein that contains epidermal growth factor (EGF)-like repeats. The encoded heterotrimeric protein may be involved in cell growth regulation and differentiation. A similar protein in rodents is involved in craniosynostosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous mice display perinatal lethality, respiratory failure, impaired development of the intervertebral disks, vertebrae and calvarial bones, increased skull length, and abnormal curvature of the spine. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Gene trapped(2) Chemically induced(9)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579C12Rik T A 9: 89,044,347 (GRCm39) noncoding transcript Het
Ada A T 2: 163,577,380 (GRCm39) I36N probably damaging Het
Armh3 A T 19: 45,808,763 (GRCm39) Y643N probably damaging Het
Atg7 T C 6: 114,678,939 (GRCm39) V384A probably benign Het
Ccl1 T A 11: 82,070,519 (GRCm39) I18L probably benign Het
Cep70 T A 9: 99,144,662 (GRCm39) C66S possibly damaging Het
D16Ertd472e A T 16: 78,372,894 (GRCm39) D14E probably damaging Het
Dnah9 T C 11: 66,024,461 (GRCm39) K278E probably benign Het
Dsg1a C A 18: 20,457,087 (GRCm39) N153K probably damaging Het
Galnt5 T A 2: 57,888,472 (GRCm39) I24N probably damaging Het
Grid1 A T 14: 35,172,358 (GRCm39) probably benign Het
Gtf2a1 T C 12: 91,542,441 (GRCm39) H47R probably benign Het
Igf1r A G 7: 67,839,810 (GRCm39) T706A possibly damaging Het
Itih4 A T 14: 30,616,995 (GRCm39) N517I probably damaging Het
Jam3 C A 9: 27,013,159 (GRCm39) probably null Het
Katnip A G 7: 125,467,913 (GRCm39) I1366V probably benign Het
Klk1b4 A G 7: 43,860,179 (GRCm39) M98V probably benign Het
Kndc1 A G 7: 139,504,044 (GRCm39) E1116G probably benign Het
Ksr2 C T 5: 117,693,127 (GRCm39) R192* probably null Het
L3mbtl4 T C 17: 69,084,909 (GRCm39) S607P possibly damaging Het
Map6 T C 7: 98,917,256 (GRCm39) C10R probably damaging Het
Myo3a A G 2: 22,467,712 (GRCm39) E322G probably damaging Het
Npm3 T C 19: 45,736,692 (GRCm39) E149G possibly damaging Het
Or4k35 C T 2: 111,099,927 (GRCm39) V262I probably benign Het
Or5h24 G A 16: 58,919,124 (GRCm39) T77I unknown Het
Orc3 G A 4: 34,587,055 (GRCm39) Q345* probably null Het
Otol1 A G 3: 69,935,112 (GRCm39) D368G probably damaging Het
Pals1 G A 12: 78,871,613 (GRCm39) E398K probably benign Het
Pramel26 T A 4: 143,538,170 (GRCm39) N267I probably benign Het
Prss40 G T 1: 34,599,960 (GRCm39) S9* probably null Het
Radx C T X: 138,407,752 (GRCm39) S364L probably damaging Het
Reln A T 5: 22,333,630 (GRCm39) V264D possibly damaging Het
Rpp40 A G 13: 36,082,549 (GRCm39) C275R probably benign Het
Scaf1 G A 7: 44,655,798 (GRCm39) probably benign Het
Sncaip A G 18: 53,040,475 (GRCm39) T890A probably benign Het
Spata6l A T 19: 28,923,183 (GRCm39) C80S possibly damaging Het
Thada A G 17: 84,749,135 (GRCm39) V612A probably benign Het
Tsnaxip1 G A 8: 106,560,177 (GRCm39) probably null Het
Vcan T A 13: 89,840,662 (GRCm39) L1627F probably benign Het
Vrtn T C 12: 84,695,844 (GRCm39) I198T probably damaging Het
Wnt9b T C 11: 103,622,824 (GRCm39) D193G probably damaging Het
Znrd2 T C 19: 5,780,431 (GRCm39) E189G probably damaging Het
Zswim5 A G 4: 116,843,899 (GRCm39) D979G probably damaging Het
Other mutations in Nell1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Nell1 APN 7 49,770,421 (GRCm39) missense probably damaging 0.96
IGL01434:Nell1 APN 7 50,350,956 (GRCm39) missense probably benign 0.01
IGL01796:Nell1 APN 7 49,825,964 (GRCm39) splice site probably benign
IGL02048:Nell1 APN 7 49,869,355 (GRCm39) missense probably damaging 0.96
IGL02239:Nell1 APN 7 49,899,398 (GRCm39) missense probably benign 0.08
IGL02860:Nell1 APN 7 50,498,233 (GRCm39) missense probably damaging 0.99
IGL02958:Nell1 APN 7 49,870,085 (GRCm39) critical splice donor site probably null
IGL03143:Nell1 APN 7 49,929,281 (GRCm39) nonsense probably null
IGL03334:Nell1 APN 7 49,712,359 (GRCm39) splice site probably null
D6062:Nell1 UTSW 7 49,907,939 (GRCm39) missense probably benign 0.21
P0018:Nell1 UTSW 7 49,770,439 (GRCm39) missense probably damaging 1.00
R0004:Nell1 UTSW 7 50,210,507 (GRCm39) splice site probably benign
R0029:Nell1 UTSW 7 49,770,463 (GRCm39) splice site probably benign
R0029:Nell1 UTSW 7 49,770,463 (GRCm39) splice site probably benign
R0468:Nell1 UTSW 7 49,878,594 (GRCm39) missense probably damaging 0.97
R0483:Nell1 UTSW 7 49,879,928 (GRCm39) missense probably benign 0.07
R0732:Nell1 UTSW 7 50,506,135 (GRCm39) missense probably damaging 1.00
R0945:Nell1 UTSW 7 49,869,333 (GRCm39) missense probably benign 0.07
R1022:Nell1 UTSW 7 49,770,411 (GRCm39) missense probably damaging 1.00
R1024:Nell1 UTSW 7 49,770,411 (GRCm39) missense probably damaging 1.00
R1075:Nell1 UTSW 7 50,503,588 (GRCm39) missense probably damaging 0.98
R1291:Nell1 UTSW 7 49,879,998 (GRCm39) missense probably benign 0.00
R1404:Nell1 UTSW 7 50,503,621 (GRCm39) missense possibly damaging 0.91
R1404:Nell1 UTSW 7 50,503,621 (GRCm39) missense possibly damaging 0.91
R1634:Nell1 UTSW 7 50,498,306 (GRCm39) missense possibly damaging 0.82
R1928:Nell1 UTSW 7 50,350,943 (GRCm39) missense possibly damaging 0.51
R2060:Nell1 UTSW 7 50,210,578 (GRCm39) missense possibly damaging 0.58
R2261:Nell1 UTSW 7 50,210,569 (GRCm39) missense possibly damaging 0.95
R2262:Nell1 UTSW 7 50,210,569 (GRCm39) missense possibly damaging 0.95
R2263:Nell1 UTSW 7 50,210,569 (GRCm39) missense possibly damaging 0.95
R2448:Nell1 UTSW 7 50,506,135 (GRCm39) missense probably damaging 1.00
R2869:Nell1 UTSW 7 49,899,405 (GRCm39) intron probably benign
R2870:Nell1 UTSW 7 49,899,405 (GRCm39) intron probably benign
R2871:Nell1 UTSW 7 49,899,405 (GRCm39) intron probably benign
R3498:Nell1 UTSW 7 49,907,927 (GRCm39) missense possibly damaging 0.55
R4623:Nell1 UTSW 7 49,770,310 (GRCm39) missense possibly damaging 0.84
R4732:Nell1 UTSW 7 50,505,965 (GRCm39) missense probably damaging 1.00
R4733:Nell1 UTSW 7 50,505,965 (GRCm39) missense probably damaging 1.00
R4941:Nell1 UTSW 7 49,712,386 (GRCm39) missense probably benign 0.10
R4942:Nell1 UTSW 7 49,770,397 (GRCm39) missense possibly damaging 0.84
R5233:Nell1 UTSW 7 49,826,062 (GRCm39) missense probably damaging 0.99
R5590:Nell1 UTSW 7 49,929,359 (GRCm39) missense probably damaging 1.00
R5673:Nell1 UTSW 7 49,878,594 (GRCm39) missense probably damaging 0.99
R5741:Nell1 UTSW 7 50,210,638 (GRCm39) splice site probably null
R6345:Nell1 UTSW 7 49,625,171 (GRCm39) missense possibly damaging 0.91
R6916:Nell1 UTSW 7 50,350,927 (GRCm39) missense probably benign 0.00
R7051:Nell1 UTSW 7 50,098,592 (GRCm39) missense unknown
R7302:Nell1 UTSW 7 50,506,017 (GRCm39) missense probably benign
R7339:Nell1 UTSW 7 49,929,297 (GRCm39) missense probably benign 0.01
R7831:Nell1 UTSW 7 49,632,548 (GRCm39) missense possibly damaging 0.85
R7913:Nell1 UTSW 7 49,929,270 (GRCm39) missense possibly damaging 0.93
R8094:Nell1 UTSW 7 49,770,335 (GRCm39) missense probably benign 0.02
R8191:Nell1 UTSW 7 50,098,622 (GRCm39) missense unknown
R8207:Nell1 UTSW 7 49,869,760 (GRCm39) splice site probably null
R8292:Nell1 UTSW 7 49,907,995 (GRCm39) missense probably damaging 1.00
R8340:Nell1 UTSW 7 49,870,021 (GRCm39) missense probably damaging 0.98
R8673:Nell1 UTSW 7 49,869,343 (GRCm39) missense probably damaging 1.00
R8821:Nell1 UTSW 7 50,476,097 (GRCm39) missense probably damaging 0.98
R8987:Nell1 UTSW 7 50,498,399 (GRCm39) missense probably damaging 1.00
R8988:Nell1 UTSW 7 50,210,543 (GRCm39) missense unknown
R9095:Nell1 UTSW 7 50,506,150 (GRCm39) missense possibly damaging 0.92
R9300:Nell1 UTSW 7 49,712,368 (GRCm39) missense probably benign
R9370:Nell1 UTSW 7 49,770,292 (GRCm39) missense probably damaging 1.00
R9422:Nell1 UTSW 7 49,712,387 (GRCm39) nonsense probably null
R9428:Nell1 UTSW 7 50,503,683 (GRCm39) missense probably damaging 1.00
R9445:Nell1 UTSW 7 49,632,474 (GRCm39) missense possibly damaging 0.78
Z1176:Nell1 UTSW 7 50,210,630 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- ATGCAGATATCCCCTACTGCG -3'
(R):5'- GACCCAGTAATATCGACGTCAG -3'

Sequencing Primer
(F):5'- CTGTGACCTTCTCAAGATGAATG -3'
(R):5'- ATCGACGTCAGATAATCCTTCTACTG -3'
Posted On 2015-04-30