Incidental Mutation 'R4044:Jam3'
ID 313989
Institutional Source Beutler Lab
Gene Symbol Jam3
Ensembl Gene ENSMUSG00000031990
Gene Name junction adhesion molecule 3
Synonyms 1110002N23Rik, Jcam3, JAM-3, JAM-C
MMRRC Submission 040967-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.592) question?
Stock # R4044 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 27008680-27066717 bp(-) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to A at 27013159 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000034472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034472]
AlphaFold Q9D8B7
Predicted Effect probably null
Transcript: ENSMUST00000034472
SMART Domains Protein: ENSMUSP00000034472
Gene: ENSMUSG00000031990

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
IG 38 136 2.7e-9 SMART
IGc2 151 226 8.12e-13 SMART
transmembrane domain 245 267 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167074
SMART Domains Protein: ENSMUSP00000128003
Gene: ENSMUSG00000031990

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 18 24 N/A INTRINSIC
IG 38 136 2.7e-9 SMART
Pfam:C2-set_2 138 206 4.8e-7 PFAM
Pfam:Ig_3 139 206 7.1e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213170
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213682
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215446
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217654
Meta Mutation Damage Score 0.9500 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Tight junctions represent one mode of cell-to-cell adhesion in epithelial or endothelial cell sheets, forming continuous seals around cells and serving as a physical barrier to prevent solutes and water from passing freely through the paracellular space. The protein encoded by this immunoglobulin superfamily gene member is localized in the tight junctions between high endothelial cells. Unlike other proteins in this family, the this protein is unable to adhere to leukocyte cell lines and only forms weak homotypic interactions. The encoded protein is a member of the junctional adhesion molecule protein family and acts as a receptor for another member of this family. A mutation in an intron of this gene is associated with hemorrhagic destruction of the brain, subependymal calcification, and congenital cataracts. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Apr 2011]
PHENOTYPE: Approximately 60% of mice homozygous for a targeted mutation exhibit postnatal lethality. Males are infertile and display small testes and arrested differentiation of round spermatids into spermatozoa, as shown by the absence of acrosomes, elongated nuclei, and morphological signs of polarization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579C12Rik T A 9: 89,044,347 (GRCm39) noncoding transcript Het
Ada A T 2: 163,577,380 (GRCm39) I36N probably damaging Het
Armh3 A T 19: 45,808,763 (GRCm39) Y643N probably damaging Het
Atg7 T C 6: 114,678,939 (GRCm39) V384A probably benign Het
Ccl1 T A 11: 82,070,519 (GRCm39) I18L probably benign Het
Cep70 T A 9: 99,144,662 (GRCm39) C66S possibly damaging Het
D16Ertd472e A T 16: 78,372,894 (GRCm39) D14E probably damaging Het
Dnah9 T C 11: 66,024,461 (GRCm39) K278E probably benign Het
Dsg1a C A 18: 20,457,087 (GRCm39) N153K probably damaging Het
Galnt5 T A 2: 57,888,472 (GRCm39) I24N probably damaging Het
Grid1 A T 14: 35,172,358 (GRCm39) probably benign Het
Gtf2a1 T C 12: 91,542,441 (GRCm39) H47R probably benign Het
Igf1r A G 7: 67,839,810 (GRCm39) T706A possibly damaging Het
Itih4 A T 14: 30,616,995 (GRCm39) N517I probably damaging Het
Katnip A G 7: 125,467,913 (GRCm39) I1366V probably benign Het
Klk1b4 A G 7: 43,860,179 (GRCm39) M98V probably benign Het
Kndc1 A G 7: 139,504,044 (GRCm39) E1116G probably benign Het
Ksr2 C T 5: 117,693,127 (GRCm39) R192* probably null Het
L3mbtl4 T C 17: 69,084,909 (GRCm39) S607P possibly damaging Het
Map6 T C 7: 98,917,256 (GRCm39) C10R probably damaging Het
Myo3a A G 2: 22,467,712 (GRCm39) E322G probably damaging Het
Nell1 A G 7: 49,869,367 (GRCm39) N214S probably damaging Het
Npm3 T C 19: 45,736,692 (GRCm39) E149G possibly damaging Het
Or4k35 C T 2: 111,099,927 (GRCm39) V262I probably benign Het
Or5h24 G A 16: 58,919,124 (GRCm39) T77I unknown Het
Orc3 G A 4: 34,587,055 (GRCm39) Q345* probably null Het
Otol1 A G 3: 69,935,112 (GRCm39) D368G probably damaging Het
Pals1 G A 12: 78,871,613 (GRCm39) E398K probably benign Het
Pramel26 T A 4: 143,538,170 (GRCm39) N267I probably benign Het
Prss40 G T 1: 34,599,960 (GRCm39) S9* probably null Het
Radx C T X: 138,407,752 (GRCm39) S364L probably damaging Het
Reln A T 5: 22,333,630 (GRCm39) V264D possibly damaging Het
Rpp40 A G 13: 36,082,549 (GRCm39) C275R probably benign Het
Scaf1 G A 7: 44,655,798 (GRCm39) probably benign Het
Sncaip A G 18: 53,040,475 (GRCm39) T890A probably benign Het
Spata6l A T 19: 28,923,183 (GRCm39) C80S possibly damaging Het
Thada A G 17: 84,749,135 (GRCm39) V612A probably benign Het
Tsnaxip1 G A 8: 106,560,177 (GRCm39) probably null Het
Vcan T A 13: 89,840,662 (GRCm39) L1627F probably benign Het
Vrtn T C 12: 84,695,844 (GRCm39) I198T probably damaging Het
Wnt9b T C 11: 103,622,824 (GRCm39) D193G probably damaging Het
Znrd2 T C 19: 5,780,431 (GRCm39) E189G probably damaging Het
Zswim5 A G 4: 116,843,899 (GRCm39) D979G probably damaging Het
Other mutations in Jam3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Jam3 APN 9 27,013,188 (GRCm39) missense probably damaging 1.00
IGL01311:Jam3 APN 9 27,010,019 (GRCm39) missense probably damaging 0.99
IGL01729:Jam3 APN 9 27,016,821 (GRCm39) missense probably damaging 1.00
IGL03233:Jam3 APN 9 27,013,217 (GRCm39) missense probably damaging 1.00
IGL03275:Jam3 APN 9 27,012,545 (GRCm39) missense probably damaging 0.99
R0267:Jam3 UTSW 9 27,017,701 (GRCm39) missense probably benign 0.01
R0547:Jam3 UTSW 9 27,010,184 (GRCm39) missense probably damaging 1.00
R0899:Jam3 UTSW 9 27,010,253 (GRCm39) missense probably damaging 1.00
R1499:Jam3 UTSW 9 27,017,701 (GRCm39) missense possibly damaging 0.93
R3926:Jam3 UTSW 9 27,017,701 (GRCm39) missense possibly damaging 0.93
R4977:Jam3 UTSW 9 27,009,669 (GRCm39) missense probably damaging 0.96
R6527:Jam3 UTSW 9 27,066,640 (GRCm39) missense unknown
R6759:Jam3 UTSW 9 27,013,276 (GRCm39) missense probably benign 0.09
R7843:Jam3 UTSW 9 27,017,712 (GRCm39) critical splice acceptor site probably null
R8088:Jam3 UTSW 9 27,010,156 (GRCm39) missense probably benign 0.00
R9688:Jam3 UTSW 9 27,010,204 (GRCm39) missense probably benign 0.30
R9700:Jam3 UTSW 9 27,010,183 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGTGTTCTCATCATCCCAG -3'
(R):5'- TGCTCTGCCATCAAGTCCAG -3'

Sequencing Primer
(F):5'- GTTCTCATCATCCCAGCCCAAC -3'
(R):5'- ACAGTCTTCCAGTGTCTAGGATC -3'
Posted On 2015-04-30