Incidental Mutation 'R4044:4930579C12Rik'
List |< first << previous [record 96 of 1920] next >> last >|
ID313990
Institutional Source Beutler Lab
Gene Symbol 4930579C12Rik
Ensembl Gene ENSMUSG00000074146
Gene NameRIKEN cDNA 4930579C12 gene
Synonyms
MMRRC Submission 040967-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R4044 (G1)
Quality Score144
Status Validated
Chromosome9
Chromosomal Location89113111-89177887 bp(-) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) T to A at 89162294 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000098484
SMART Domains Protein: ENSMUSP00000096085
Gene: ENSMUSG00000074146

DomainStartEndE-ValueType
low complexity region 93 110 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104277
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187015
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik A T 19: 28,945,783 C80S possibly damaging Het
9130011E15Rik A T 19: 45,820,324 Y643N probably damaging Het
Ada A T 2: 163,735,460 I36N probably damaging Het
Atg7 T C 6: 114,701,978 V384A probably benign Het
Ccl1 T A 11: 82,179,693 I18L probably benign Het
Cep70 T A 9: 99,262,609 C66S possibly damaging Het
D16Ertd472e A T 16: 78,576,006 D14E probably damaging Het
D330045A20Rik C T X: 139,507,003 S364L probably damaging Het
D430042O09Rik A G 7: 125,868,741 I1366V probably benign Het
Dnah9 T C 11: 66,133,635 K278E probably benign Het
Dsg1a C A 18: 20,324,030 N153K probably damaging Het
Galnt5 T A 2: 57,998,460 I24N probably damaging Het
Gm13084 T A 4: 143,811,600 N267I probably benign Het
Grid1 A T 14: 35,450,401 probably benign Het
Gtf2a1 T C 12: 91,575,667 H47R probably benign Het
Igf1r A G 7: 68,190,062 T706A possibly damaging Het
Itih4 A T 14: 30,895,038 N517I probably damaging Het
Jam3 C A 9: 27,101,863 probably null Het
Klk1b4 A G 7: 44,210,755 M98V probably benign Het
Kndc1 A G 7: 139,924,129 E1116G probably benign Het
Ksr2 C T 5: 117,555,062 R192* probably null Het
L3mbtl4 T C 17: 68,777,914 S607P possibly damaging Het
Map6 T C 7: 99,268,049 C10R probably damaging Het
Mpp5 G A 12: 78,824,839 E398K probably benign Het
Myo3a A G 2: 22,577,700 E322G probably damaging Het
Nell1 A G 7: 50,219,619 N214S probably damaging Het
Npm3 T C 19: 45,748,253 E149G possibly damaging Het
Olfr1277 C T 2: 111,269,582 V262I probably benign Het
Olfr192 G A 16: 59,098,761 T77I unknown Het
Orc3 G A 4: 34,587,055 Q345* probably null Het
Otol1 A G 3: 70,027,779 D368G probably damaging Het
Prss40 G T 1: 34,560,879 S9* probably null Het
Reln A T 5: 22,128,632 V264D possibly damaging Het
Rpp40 A G 13: 35,898,566 C275R probably benign Het
Scaf1 G A 7: 45,006,374 probably benign Het
Sncaip A G 18: 52,907,403 T890A probably benign Het
Sssca1 T C 19: 5,730,403 E189G probably damaging Het
Thada A G 17: 84,441,707 V612A probably benign Het
Tsnaxip1 G A 8: 105,833,545 probably null Het
Vcan T A 13: 89,692,543 L1627F probably benign Het
Vrtn T C 12: 84,649,070 I198T probably damaging Het
Wnt9b T C 11: 103,731,998 D193G probably damaging Het
Zswim5 A G 4: 116,986,702 D979G probably damaging Het
Other mutations in 4930579C12Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0798:4930579C12Rik UTSW 9 89152827 exon noncoding transcript
R0837:4930579C12Rik UTSW 9 89168207 splice site noncoding transcript
R1804:4930579C12Rik UTSW 9 89152060 splice site noncoding transcript
R1861:4930579C12Rik UTSW 9 89152831 exon noncoding transcript
R1889:4930579C12Rik UTSW 9 89152762 splice site noncoding transcript
R5294:4930579C12Rik UTSW 9 89152003 exon noncoding transcript
R5454:4930579C12Rik UTSW 9 89168988 critical splice acceptor site noncoding transcript
R5756:4930579C12Rik UTSW 9 89128866 critical splice donor site noncoding transcript
Predicted Primers PCR Primer
(F):5'- GGAATCACAGTTGAACACAGTAAC -3'
(R):5'- AGGAAGTACAGAGCTCCAGC -3'

Sequencing Primer
(F):5'- CCACAGACACATGGCCGTTATTTATG -3'
(R):5'- TCTTCTGTTTCGTCACTAAATAATGG -3'
Posted On2015-04-30