Incidental Mutation 'R4049:Plekha5'
ID314034
Institutional Source Beutler Lab
Gene Symbol Plekha5
Ensembl Gene ENSMUSG00000030231
Gene Namepleckstrin homology domain containing, family A member 5
SynonymsPEPP2, Tg(AMH-cre)1Flor, Gt(Ayu21)9Imeg, AMH-Cre, 2810431N21Rik, Ayu21-9
MMRRC Submission 041616-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.251) question?
Stock #R4049 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location140424054-140597110 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 140583871 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 75 (S75P)
Ref Sequence ENSEMBL: ENSMUSP00000145219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087622] [ENSMUST00000203012] [ENSMUST00000203483] [ENSMUST00000203517] [ENSMUST00000204080] [ENSMUST00000204145] [ENSMUST00000205026] [ENSMUST00000213444]
Predicted Effect probably damaging
Transcript: ENSMUST00000087622
AA Change: S1020P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084904
Gene: ENSMUSG00000030231
AA Change: S1020P

DomainStartEndE-ValueType
WW 12 44 1.51e-3 SMART
WW 58 90 2.17e-4 SMART
PH 171 271 1.85e-17 SMART
Blast:PH 592 715 7e-39 BLAST
coiled coil region 747 781 N/A INTRINSIC
low complexity region 896 916 N/A INTRINSIC
low complexity region 924 938 N/A INTRINSIC
low complexity region 1206 1224 N/A INTRINSIC
low complexity region 1243 1258 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000203012
AA Change: S541P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145499
Gene: ENSMUSG00000030231
AA Change: S541P

DomainStartEndE-ValueType
Blast:PH 210 250 2e-8 BLAST
coiled coil region 268 302 N/A INTRINSIC
low complexity region 417 437 N/A INTRINSIC
low complexity region 445 459 N/A INTRINSIC
low complexity region 727 745 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203315
Predicted Effect probably damaging
Transcript: ENSMUST00000203483
AA Change: S75P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145219
Gene: ENSMUSG00000030231
AA Change: S75P

DomainStartEndE-ValueType
low complexity region 261 279 N/A INTRINSIC
low complexity region 298 313 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000203517
AA Change: S912P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145478
Gene: ENSMUSG00000030231
AA Change: S912P

DomainStartEndE-ValueType
WW 12 44 9e-6 SMART
WW 58 90 1.3e-6 SMART
PH 171 271 8.6e-20 SMART
Blast:PH 586 697 3e-15 BLAST
coiled coil region 702 736 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000203955
AA Change: S867P
Predicted Effect possibly damaging
Transcript: ENSMUST00000204080
AA Change: S488P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144872
Gene: ENSMUSG00000030231
AA Change: S488P

DomainStartEndE-ValueType
Blast:PH 220 260 1e-8 BLAST
coiled coil region 278 312 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204145
SMART Domains Protein: ENSMUSP00000145457
Gene: ENSMUSG00000030231

DomainStartEndE-ValueType
WW 12 44 9e-6 SMART
WW 58 90 1.3e-6 SMART
Blast:PH 114 151 6e-14 BLAST
PDB:2DKP|A 163 196 1e-5 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204528
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204755
Predicted Effect probably benign
Transcript: ENSMUST00000205026
AA Change: S433P

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000144973
Gene: ENSMUSG00000030231
AA Change: S433P

DomainStartEndE-ValueType
Blast:PH 165 205 1e-8 BLAST
coiled coil region 223 257 N/A INTRINSIC
low complexity region 619 637 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205255
Predicted Effect possibly damaging
Transcript: ENSMUST00000213444
AA Change: S347P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.298 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T A 12: 118,868,669 E1190V probably damaging Het
Arhgef10 A G 8: 14,979,998 T928A probably benign Het
Arhgef10l T A 4: 140,515,451 I836F probably benign Het
Blm T A 7: 80,502,862 T446S probably benign Het
Ccdc63 T A 5: 122,122,750 Q237L probably damaging Het
Cep57l1 G T 10: 41,729,360 R130S probably damaging Het
Clstn2 T G 9: 97,457,560 E786A possibly damaging Het
Col16a1 C T 4: 130,068,752 P540L probably damaging Het
Csf2 A G 11: 54,249,333 F61L probably damaging Het
Ctr9 C T 7: 111,055,543 R1094C unknown Het
Cyp3a41a A G 5: 145,713,540 C98R probably damaging Het
Dthd1 T A 5: 62,827,165 C404* probably null Het
Egfem1 A C 3: 29,686,731 H518P probably benign Het
Elf3 T C 1: 135,254,277 S369G probably benign Het
Eml6 C T 11: 29,838,577 V503M probably damaging Het
Enthd1 T C 15: 80,560,039 D105G probably damaging Het
Eral1 A G 11: 78,075,602 L250P probably damaging Het
Gdf15 A T 8: 70,629,955 M167K probably benign Het
Ggps1 T C 13: 14,053,699 K300E probably benign Het
Gm8074 G A 9: 78,322,336 noncoding transcript Het
Herc3 A G 6: 58,876,837 I623V probably damaging Het
Mad1l1 A G 5: 140,132,816 S457P probably damaging Het
Map1lc3a G T 2: 155,277,542 V91F possibly damaging Het
Map4k3 A G 17: 80,605,965 V617A probably benign Het
Mov10l1 T A 15: 88,995,032 probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Ncor1 G T 11: 62,329,668 probably null Het
Nfe2 C T 15: 103,250,937 E36K possibly damaging Het
Olfr1176 T C 2: 88,343,800 probably null Het
Olfr1212 A G 2: 88,959,273 K269R probably benign Het
Olfr1251 T C 2: 89,667,662 I75V probably benign Het
Olfr653 T C 7: 104,580,368 F241L probably benign Het
Oprm1 G A 10: 6,829,087 V95I probably benign Het
Pcdha9 T A 18: 36,997,942 H21Q probably benign Het
Pcolce2 A T 9: 95,638,755 I62F probably damaging Het
Pfpl T A 19: 12,429,689 C435S probably damaging Het
Pkhd1l1 G A 15: 44,498,557 C542Y probably damaging Het
Pphln1 C A 15: 93,465,106 A202E probably damaging Het
Ppp1r1a A G 15: 103,532,454 L92P probably damaging Het
Prokr2 T C 2: 132,381,494 T43A probably benign Het
Rai14 T C 15: 10,592,212 N199S probably benign Het
Rasgrp2 T C 19: 6,404,727 L199P probably damaging Het
Rnf213 A C 11: 119,482,448 M4939L possibly damaging Het
Slc23a2 C T 2: 132,060,683 R533Q probably benign Het
Slc7a7 T C 14: 54,373,091 probably null Het
Snrpd2 T A 7: 19,151,307 V31E probably damaging Het
Spire1 G T 18: 67,529,031 probably null Het
Srsf4 T C 4: 131,900,543 probably benign Het
Tcf20 A G 15: 82,853,429 S1274P probably damaging Het
Tcof1 C A 18: 60,832,903 A376S possibly damaging Het
Thsd1 T A 8: 22,243,164 Y76N possibly damaging Het
Timm44 A G 8: 4,260,561 V397A probably benign Het
Tmc6 G A 11: 117,778,261 T89I possibly damaging Het
Trbv31 C A 6: 41,557,705 C107F probably damaging Het
Trim37 T A 11: 87,140,603 probably null Het
Ttll5 T C 12: 86,012,799 V1226A probably benign Het
Ube3b T C 5: 114,412,870 V865A probably benign Het
Vmn2r86 A T 10: 130,447,097 M550K probably damaging Het
Vps54 C A 11: 21,300,183 T373N probably benign Het
Wdr64 T G 1: 175,805,856 I891S probably benign Het
Wisp2 A G 2: 163,828,984 D137G probably damaging Het
Zfhx4 C T 3: 5,398,859 S1384L probably damaging Het
Zfp703 A G 8: 26,979,085 E259G possibly damaging Het
Zfp933 T C 4: 147,826,512 H209R probably damaging Het
Zfp980 A G 4: 145,702,600 H633R probably damaging Het
Other mutations in Plekha5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Plekha5 APN 6 140570096 splice site probably benign
IGL00908:Plekha5 APN 6 140550930 missense probably damaging 1.00
IGL01346:Plekha5 APN 6 140534566 splice site probably benign
IGL01380:Plekha5 APN 6 140570316 splice site probably benign
IGL01406:Plekha5 APN 6 140572950 missense probably damaging 0.99
IGL01408:Plekha5 APN 6 140570316 splice site probably benign
IGL01688:Plekha5 APN 6 140569389 missense probably damaging 0.98
IGL01719:Plekha5 APN 6 140570129 missense probably damaging 1.00
IGL01926:Plekha5 APN 6 140525916 missense probably benign 0.12
IGL01936:Plekha5 APN 6 140524895 missense probably damaging 1.00
IGL02326:Plekha5 APN 6 140583850 nonsense probably null
IGL02544:Plekha5 APN 6 140589728 missense possibly damaging 0.78
IGL02573:Plekha5 APN 6 140582016 missense probably damaging 1.00
IGL02704:Plekha5 APN 6 140543866 missense probably damaging 1.00
IGL02959:Plekha5 APN 6 140544178 missense probably damaging 1.00
Doubletime UTSW 6 140525929 nonsense probably null
R0067:Plekha5 UTSW 6 140524903 missense probably damaging 1.00
R0067:Plekha5 UTSW 6 140524903 missense probably damaging 1.00
R0095:Plekha5 UTSW 6 140528597 missense probably damaging 1.00
R0095:Plekha5 UTSW 6 140528597 missense probably damaging 1.00
R0105:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0107:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0359:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0360:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0362:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0363:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0364:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0365:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0833:Plekha5 UTSW 6 140589634 splice site probably benign
R0835:Plekha5 UTSW 6 140568850 nonsense probably null
R0836:Plekha5 UTSW 6 140589634 splice site probably benign
R0944:Plekha5 UTSW 6 140570196 splice site probably benign
R2015:Plekha5 UTSW 6 140534564 critical splice donor site probably null
R2043:Plekha5 UTSW 6 140552804 splice site probably benign
R2086:Plekha5 UTSW 6 140570318 splice site probably null
R2102:Plekha5 UTSW 6 140572877 missense probably damaging 1.00
R2109:Plekha5 UTSW 6 140424216 missense possibly damaging 0.56
R2135:Plekha5 UTSW 6 140580499 missense possibly damaging 0.66
R2150:Plekha5 UTSW 6 140570403 missense probably damaging 1.00
R2211:Plekha5 UTSW 6 140525861 missense possibly damaging 0.56
R2414:Plekha5 UTSW 6 140550856 missense probably damaging 1.00
R2915:Plekha5 UTSW 6 140589199 missense probably damaging 0.96
R3120:Plekha5 UTSW 6 140591641 missense probably benign 0.00
R3924:Plekha5 UTSW 6 140570379 missense possibly damaging 0.78
R4056:Plekha5 UTSW 6 140589232 missense possibly damaging 0.46
R4077:Plekha5 UTSW 6 140555921 intron probably null
R4320:Plekha5 UTSW 6 140543817 missense possibly damaging 0.68
R4343:Plekha5 UTSW 6 140556054 missense probably damaging 0.99
R4359:Plekha5 UTSW 6 140591688 missense probably benign 0.07
R4377:Plekha5 UTSW 6 140579465 missense probably damaging 1.00
R4480:Plekha5 UTSW 6 140526479 missense probably damaging 1.00
R4533:Plekha5 UTSW 6 140570331 missense probably damaging 1.00
R4623:Plekha5 UTSW 6 140551186 missense probably damaging 0.98
R4672:Plekha5 UTSW 6 140524929 missense probably damaging 0.98
R4871:Plekha5 UTSW 6 140525910 missense probably damaging 1.00
R4903:Plekha5 UTSW 6 140586367 missense probably damaging 1.00
R5121:Plekha5 UTSW 6 140579474 missense probably damaging 1.00
R5156:Plekha5 UTSW 6 140426528 missense probably damaging 1.00
R5376:Plekha5 UTSW 6 140551144 missense probably damaging 1.00
R5445:Plekha5 UTSW 6 140552733 nonsense probably null
R5753:Plekha5 UTSW 6 140537004 critical splice acceptor site probably null
R5836:Plekha5 UTSW 6 140426524 missense probably damaging 1.00
R5972:Plekha5 UTSW 6 140572913 missense possibly damaging 0.78
R6196:Plekha5 UTSW 6 140579453 missense probably benign 0.28
R6254:Plekha5 UTSW 6 140586436 missense probably damaging 1.00
R6501:Plekha5 UTSW 6 140525929 nonsense probably null
R6620:Plekha5 UTSW 6 140572875 missense probably damaging 1.00
R6663:Plekha5 UTSW 6 140577290 missense probably damaging 1.00
R6823:Plekha5 UTSW 6 140525858 missense probably benign 0.16
R6992:Plekha5 UTSW 6 140543908 missense probably damaging 1.00
R7196:Plekha5 UTSW 6 140543922 missense possibly damaging 0.83
R7487:Plekha5 UTSW 6 140570333 missense probably benign 0.25
X0027:Plekha5 UTSW 6 140424423 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGCCTGTGTGTCAAGTGG -3'
(R):5'- GGTTGACCAAGATACCGTGC -3'

Sequencing Primer
(F):5'- CAGGAGAACACTCACTGTTGATG -3'
(R):5'- TGCTTGGCTGTCCTGAACAAAAAG -3'
Posted On2015-04-30