Incidental Mutation 'R4049:Rnf213'
ID 314057
Institutional Source Beutler Lab
Gene Symbol Rnf213
Ensembl Gene ENSMUSG00000070327
Gene Name ring finger protein 213
Synonyms D11Ertd759e
MMRRC Submission 041616-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4049 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 119283926-119378244 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 119373274 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 4939 (M4939L)
Ref Sequence ENSEMBL: ENSMUSP00000091429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093902] [ENSMUST00000131035] [ENSMUST00000172235]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000093902
AA Change: M4939L

PolyPhen 2 Score 0.667 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000091429
Gene: ENSMUSG00000070327
AA Change: M4939L

DomainStartEndE-ValueType
low complexity region 130 146 N/A INTRINSIC
low complexity region 265 279 N/A INTRINSIC
low complexity region 319 335 N/A INTRINSIC
low complexity region 676 688 N/A INTRINSIC
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1546 1558 N/A INTRINSIC
AAA 2373 2515 2.82e-2 SMART
AAA 2722 2890 3.63e-1 SMART
low complexity region 3449 3459 N/A INTRINSIC
RING 3947 3985 8.69e-5 SMART
Blast:PP2Ac 4544 4722 3e-66 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000131035
AA Change: M4938L

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000115063
Gene: ENSMUSG00000070327
AA Change: M4938L

DomainStartEndE-ValueType
low complexity region 130 146 N/A INTRINSIC
low complexity region 265 279 N/A INTRINSIC
low complexity region 319 335 N/A INTRINSIC
low complexity region 676 688 N/A INTRINSIC
low complexity region 1113 1127 N/A INTRINSIC
low complexity region 1545 1557 N/A INTRINSIC
AAA 2372 2514 2.82e-2 SMART
AAA 2721 2889 3.63e-1 SMART
low complexity region 3448 3458 N/A INTRINSIC
RING 3946 3984 8.69e-5 SMART
Blast:PP2Ac 4542 4720 3e-66 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000172235
AA Change: M99L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207133
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207273
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207446
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208476
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208152
Meta Mutation Damage Score 0.0749 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a C3HC4-type RING finger domain, which is a specialized type of Zn-finger that binds two atoms of zinc and is thought to be involved in mediating protein-protein interactions. The protein also contains an AAA domain, which is associated with ATPase activity. This gene is a susceptibility gene for Moyamoya disease, a vascular disorder of intracranial arteries. This gene is also a translocation partner in anaplastic large cell lymphoma and inflammatory myofibroblastic tumor cases, where a t(2;17)(p23;q25) translocation has been identified with the anaplastic lymphoma kinase (ALK) gene on chromosome 2, and a t(8;17)(q24;q25) translocation has been identified with the MYC gene on chromosome 8. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and circulating glucose level but normal glucose tolerance, insulin sensitivity, insulin plasma levels and leptin plasma levels. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T A 12: 118,832,404 (GRCm39) E1190V probably damaging Het
Arhgef10 A G 8: 15,029,998 (GRCm39) T928A probably benign Het
Arhgef10l T A 4: 140,242,762 (GRCm39) I836F probably benign Het
Blm T A 7: 80,152,610 (GRCm39) T446S probably benign Het
Ccdc63 T A 5: 122,260,813 (GRCm39) Q237L probably damaging Het
Ccn5 A G 2: 163,670,904 (GRCm39) D137G probably damaging Het
Cep57l1 G T 10: 41,605,356 (GRCm39) R130S probably damaging Het
Clstn2 T G 9: 97,339,613 (GRCm39) E786A possibly damaging Het
Col16a1 C T 4: 129,962,545 (GRCm39) P540L probably damaging Het
Csf2 A G 11: 54,140,159 (GRCm39) F61L probably damaging Het
Ctr9 C T 7: 110,654,750 (GRCm39) R1094C unknown Het
Cyp3a41a A G 5: 145,650,350 (GRCm39) C98R probably damaging Het
Dthd1 T A 5: 62,984,508 (GRCm39) C404* probably null Het
Egfem1 A C 3: 29,740,880 (GRCm39) H518P probably benign Het
Elf3 T C 1: 135,182,015 (GRCm39) S369G probably benign Het
Eml6 C T 11: 29,788,577 (GRCm39) V503M probably damaging Het
Enthd1 T C 15: 80,444,240 (GRCm39) D105G probably damaging Het
Eral1 A G 11: 77,966,428 (GRCm39) L250P probably damaging Het
Gdf15 A T 8: 71,082,605 (GRCm39) M167K probably benign Het
Ggps1 T C 13: 14,228,284 (GRCm39) K300E probably benign Het
Gm8074 G A 9: 78,229,618 (GRCm39) noncoding transcript Het
Herc3 A G 6: 58,853,822 (GRCm39) I623V probably damaging Het
Mad1l1 A G 5: 140,118,571 (GRCm39) S457P probably damaging Het
Map1lc3a G T 2: 155,119,462 (GRCm39) V91F possibly damaging Het
Map4k3 A G 17: 80,913,394 (GRCm39) V617A probably benign Het
Mov10l1 T A 15: 88,879,235 (GRCm39) probably benign Het
Mroh2a A G 1: 88,186,386 (GRCm39) S64G probably benign Het
Ncor1 G T 11: 62,220,494 (GRCm39) probably null Het
Nfe2 C T 15: 103,159,364 (GRCm39) E36K possibly damaging Het
Oprm1 G A 10: 6,779,087 (GRCm39) V95I probably benign Het
Or4a78 T C 2: 89,498,006 (GRCm39) I75V probably benign Het
Or4c107 A G 2: 88,789,617 (GRCm39) K269R probably benign Het
Or52d3 T C 7: 104,229,575 (GRCm39) F241L probably benign Het
Or5d46 T C 2: 88,174,144 (GRCm39) probably null Het
Pcdha9 T A 18: 37,130,995 (GRCm39) H21Q probably benign Het
Pcolce2 A T 9: 95,520,808 (GRCm39) I62F probably damaging Het
Pfpl T A 19: 12,407,053 (GRCm39) C435S probably damaging Het
Pkhd1l1 G A 15: 44,361,953 (GRCm39) C542Y probably damaging Het
Plekha5 T C 6: 140,529,597 (GRCm39) S75P probably damaging Het
Pphln1 C A 15: 93,362,987 (GRCm39) A202E probably damaging Het
Ppp1r1a A G 15: 103,440,881 (GRCm39) L92P probably damaging Het
Prokr2 T C 2: 132,223,414 (GRCm39) T43A probably benign Het
Rai14 T C 15: 10,592,298 (GRCm39) N199S probably benign Het
Rasgrp2 T C 19: 6,454,757 (GRCm39) L199P probably damaging Het
Slc23a2 C T 2: 131,902,603 (GRCm39) R533Q probably benign Het
Slc7a7 T C 14: 54,610,548 (GRCm39) probably null Het
Snrpd2 T A 7: 18,885,232 (GRCm39) V31E probably damaging Het
Spire1 G T 18: 67,662,101 (GRCm39) probably null Het
Srsf4 T C 4: 131,627,854 (GRCm39) probably benign Het
Tcf20 A G 15: 82,737,630 (GRCm39) S1274P probably damaging Het
Tcof1 C A 18: 60,965,975 (GRCm39) A376S possibly damaging Het
Thsd1 T A 8: 22,733,180 (GRCm39) Y76N possibly damaging Het
Timm44 A G 8: 4,310,561 (GRCm39) V397A probably benign Het
Tmc6 G A 11: 117,669,087 (GRCm39) T89I possibly damaging Het
Trbv31 C A 6: 41,534,639 (GRCm39) C107F probably damaging Het
Trim37 T A 11: 87,031,429 (GRCm39) probably null Het
Ttll5 T C 12: 86,059,573 (GRCm39) V1226A probably benign Het
Ube3b T C 5: 114,550,931 (GRCm39) V865A probably benign Het
Vmn2r86 A T 10: 130,282,966 (GRCm39) M550K probably damaging Het
Vps54 C A 11: 21,250,183 (GRCm39) T373N probably benign Het
Wdr64 T G 1: 175,633,422 (GRCm39) I891S probably benign Het
Zfhx4 C T 3: 5,463,919 (GRCm39) S1384L probably damaging Het
Zfp703 A G 8: 27,469,113 (GRCm39) E259G possibly damaging Het
Zfp933 T C 4: 147,910,969 (GRCm39) H209R probably damaging Het
Zfp980 A G 4: 145,429,170 (GRCm39) H633R probably damaging Het
Other mutations in Rnf213
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Rnf213 APN 11 119,340,169 (GRCm39) missense probably benign 0.00
IGL00961:Rnf213 APN 11 119,331,669 (GRCm39) missense possibly damaging 0.55
IGL01324:Rnf213 APN 11 119,338,063 (GRCm39) missense probably damaging 1.00
IGL01351:Rnf213 APN 11 119,373,944 (GRCm39) missense probably benign 0.25
IGL01403:Rnf213 APN 11 119,334,126 (GRCm39) missense probably damaging 1.00
IGL01704:Rnf213 APN 11 119,340,702 (GRCm39) critical splice donor site probably null
IGL01765:Rnf213 APN 11 119,327,178 (GRCm39) missense probably benign 0.00
IGL01803:Rnf213 APN 11 119,332,133 (GRCm39) missense probably damaging 1.00
IGL01804:Rnf213 APN 11 119,333,092 (GRCm39) missense probably damaging 1.00
IGL01900:Rnf213 APN 11 119,333,841 (GRCm39) missense probably benign 0.05
IGL01944:Rnf213 APN 11 119,307,283 (GRCm39) missense probably benign 0.01
IGL01982:Rnf213 APN 11 119,334,094 (GRCm39) missense probably damaging 1.00
IGL02008:Rnf213 APN 11 119,309,135 (GRCm39) splice site probably benign
IGL02084:Rnf213 APN 11 119,336,499 (GRCm39) missense probably benign 0.04
IGL02253:Rnf213 APN 11 119,331,476 (GRCm39) missense probably benign 0.03
IGL02254:Rnf213 APN 11 119,371,733 (GRCm39) missense possibly damaging 0.89
IGL02296:Rnf213 APN 11 119,354,162 (GRCm39) missense probably benign 0.01
IGL02531:Rnf213 APN 11 119,327,628 (GRCm39) missense probably benign
IGL02588:Rnf213 APN 11 119,307,362 (GRCm39) missense probably benign 0.30
IGL02615:Rnf213 APN 11 119,331,615 (GRCm39) missense probably damaging 0.96
IGL02805:Rnf213 APN 11 119,325,892 (GRCm39) missense probably damaging 0.99
IGL02887:Rnf213 APN 11 119,318,336 (GRCm39) missense probably damaging 1.00
IGL03001:Rnf213 APN 11 119,370,767 (GRCm39) missense probably damaging 1.00
IGL03035:Rnf213 APN 11 119,336,452 (GRCm39) splice site probably benign
IGL03057:Rnf213 APN 11 119,331,913 (GRCm39) missense probably damaging 1.00
IGL03148:Rnf213 APN 11 119,355,833 (GRCm39) missense probably damaging 1.00
IGL03308:Rnf213 APN 11 119,364,998 (GRCm39) missense probably benign 0.03
IGL03339:Rnf213 APN 11 119,333,830 (GRCm39) missense probably damaging 1.00
IGL03369:Rnf213 APN 11 119,312,294 (GRCm39) missense probably benign 0.34
attrition UTSW 11 119,321,147 (GRCm39) missense possibly damaging 0.77
defame UTSW 11 119,321,107 (GRCm39) nonsense probably null
Derogate UTSW 11 119,361,036 (GRCm39) missense probably damaging 1.00
dinky UTSW 11 119,307,284 (GRCm39) missense probably damaging 0.99
G1funyon_rnf213_024 UTSW 11 119,325,568 (GRCm39) missense
Impugn UTSW 11 119,327,649 (GRCm39) nonsense probably null
R4332_Rnf213_642 UTSW 11 119,327,502 (GRCm39) missense probably damaging 1.00
B6584:Rnf213 UTSW 11 119,316,895 (GRCm39) missense probably damaging 0.97
G1Funyon:Rnf213 UTSW 11 119,325,568 (GRCm39) missense
PIT4585001:Rnf213 UTSW 11 119,349,218 (GRCm39) missense
R0008:Rnf213 UTSW 11 119,355,878 (GRCm39) missense possibly damaging 0.82
R0015:Rnf213 UTSW 11 119,332,432 (GRCm39) missense possibly damaging 0.95
R0041:Rnf213 UTSW 11 119,293,401 (GRCm39) missense probably benign 0.41
R0114:Rnf213 UTSW 11 119,305,413 (GRCm39) missense probably damaging 1.00
R0131:Rnf213 UTSW 11 119,321,187 (GRCm39) missense probably benign 0.10
R0131:Rnf213 UTSW 11 119,321,187 (GRCm39) missense probably benign 0.10
R0132:Rnf213 UTSW 11 119,321,187 (GRCm39) missense probably benign 0.10
R0138:Rnf213 UTSW 11 119,307,322 (GRCm39) missense probably benign 0.05
R0144:Rnf213 UTSW 11 119,370,426 (GRCm39) nonsense probably null
R0184:Rnf213 UTSW 11 119,305,347 (GRCm39) missense probably damaging 0.99
R0321:Rnf213 UTSW 11 119,328,931 (GRCm39) nonsense probably null
R0365:Rnf213 UTSW 11 119,316,937 (GRCm39) missense possibly damaging 0.74
R0415:Rnf213 UTSW 11 119,305,295 (GRCm39) missense probably damaging 1.00
R0421:Rnf213 UTSW 11 119,338,083 (GRCm39) missense probably damaging 1.00
R0494:Rnf213 UTSW 11 119,316,838 (GRCm39) missense possibly damaging 0.65
R0494:Rnf213 UTSW 11 119,333,946 (GRCm39) missense probably damaging 1.00
R0549:Rnf213 UTSW 11 119,355,908 (GRCm39) missense probably damaging 1.00
R0577:Rnf213 UTSW 11 119,334,106 (GRCm39) missense probably damaging 1.00
R0605:Rnf213 UTSW 11 119,322,543 (GRCm39) missense probably benign 0.03
R0638:Rnf213 UTSW 11 119,361,036 (GRCm39) missense probably damaging 1.00
R0675:Rnf213 UTSW 11 119,332,660 (GRCm39) missense probably benign 0.28
R0715:Rnf213 UTSW 11 119,331,976 (GRCm39) missense probably damaging 0.97
R0732:Rnf213 UTSW 11 119,331,894 (GRCm39) missense probably damaging 0.99
R0748:Rnf213 UTSW 11 119,364,306 (GRCm39) missense probably damaging 1.00
R0765:Rnf213 UTSW 11 119,313,921 (GRCm39) critical splice donor site probably null
R0890:Rnf213 UTSW 11 119,321,312 (GRCm39) missense possibly damaging 0.94
R0927:Rnf213 UTSW 11 119,305,396 (GRCm39) missense probably benign 0.00
R0940:Rnf213 UTSW 11 119,307,389 (GRCm39) missense probably benign 0.10
R0959:Rnf213 UTSW 11 119,343,407 (GRCm39) missense probably damaging 0.99
R1077:Rnf213 UTSW 11 119,376,824 (GRCm39) splice site probably benign
R1104:Rnf213 UTSW 11 119,368,055 (GRCm39) missense probably benign 0.29
R1141:Rnf213 UTSW 11 119,326,809 (GRCm39) missense probably benign 0.02
R1219:Rnf213 UTSW 11 119,327,003 (GRCm39) missense probably damaging 1.00
R1435:Rnf213 UTSW 11 119,326,831 (GRCm39) missense probably damaging 1.00
R1444:Rnf213 UTSW 11 119,333,226 (GRCm39) missense probably damaging 1.00
R1474:Rnf213 UTSW 11 119,328,576 (GRCm39) missense probably damaging 1.00
R1488:Rnf213 UTSW 11 119,371,715 (GRCm39) missense probably benign 0.05
R1523:Rnf213 UTSW 11 119,332,714 (GRCm39) missense probably damaging 1.00
R1548:Rnf213 UTSW 11 119,333,533 (GRCm39) missense probably damaging 1.00
R1554:Rnf213 UTSW 11 119,332,665 (GRCm39) missense probably benign 0.06
R1563:Rnf213 UTSW 11 119,305,352 (GRCm39) missense probably benign 0.13
R1572:Rnf213 UTSW 11 119,327,437 (GRCm39) missense probably damaging 1.00
R1585:Rnf213 UTSW 11 119,354,171 (GRCm39) missense probably damaging 1.00
R1635:Rnf213 UTSW 11 119,333,405 (GRCm39) missense probably damaging 0.97
R1663:Rnf213 UTSW 11 119,328,498 (GRCm39) missense probably benign 0.01
R1789:Rnf213 UTSW 11 119,331,047 (GRCm39) missense probably damaging 0.97
R1844:Rnf213 UTSW 11 119,332,009 (GRCm39) missense probably damaging 1.00
R1871:Rnf213 UTSW 11 119,340,955 (GRCm39) missense probably benign 0.08
R1893:Rnf213 UTSW 11 119,307,274 (GRCm39) missense probably damaging 1.00
R1937:Rnf213 UTSW 11 119,322,511 (GRCm39) missense probably damaging 1.00
R1967:Rnf213 UTSW 11 119,371,721 (GRCm39) missense probably damaging 1.00
R1987:Rnf213 UTSW 11 119,331,933 (GRCm39) missense probably damaging 1.00
R2000:Rnf213 UTSW 11 119,326,848 (GRCm39) missense probably damaging 1.00
R2020:Rnf213 UTSW 11 119,352,744 (GRCm39) missense probably damaging 0.99
R2100:Rnf213 UTSW 11 119,358,128 (GRCm39) nonsense probably null
R2109:Rnf213 UTSW 11 119,333,489 (GRCm39) nonsense probably null
R2115:Rnf213 UTSW 11 119,318,839 (GRCm39) missense probably benign 0.00
R2126:Rnf213 UTSW 11 119,341,027 (GRCm39) missense probably damaging 0.99
R2144:Rnf213 UTSW 11 119,334,516 (GRCm39) missense probably damaging 0.99
R2145:Rnf213 UTSW 11 119,306,019 (GRCm39) missense probably benign 0.03
R2168:Rnf213 UTSW 11 119,305,896 (GRCm39) missense probably damaging 0.97
R2189:Rnf213 UTSW 11 119,321,187 (GRCm39) missense probably benign 0.10
R2199:Rnf213 UTSW 11 119,350,835 (GRCm39) missense probably benign 0.01
R2220:Rnf213 UTSW 11 119,327,254 (GRCm39) missense possibly damaging 0.94
R2336:Rnf213 UTSW 11 119,305,430 (GRCm39) missense probably benign 0.02
R2400:Rnf213 UTSW 11 119,334,021 (GRCm39) missense probably damaging 1.00
R2679:Rnf213 UTSW 11 119,350,764 (GRCm39) splice site probably null
R2698:Rnf213 UTSW 11 119,300,970 (GRCm39) missense probably benign 0.26
R3151:Rnf213 UTSW 11 119,359,718 (GRCm39) missense probably benign 0.03
R3607:Rnf213 UTSW 11 119,332,802 (GRCm39) nonsense probably null
R3808:Rnf213 UTSW 11 119,370,384 (GRCm39) missense probably damaging 1.00
R3854:Rnf213 UTSW 11 119,371,765 (GRCm39) splice site probably benign
R3856:Rnf213 UTSW 11 119,371,765 (GRCm39) splice site probably benign
R3973:Rnf213 UTSW 11 119,359,879 (GRCm39) missense
R4014:Rnf213 UTSW 11 119,336,555 (GRCm39) nonsense probably null
R4130:Rnf213 UTSW 11 119,373,832 (GRCm39) missense probably damaging 1.00
R4153:Rnf213 UTSW 11 119,300,308 (GRCm39) missense probably benign 0.27
R4167:Rnf213 UTSW 11 119,332,069 (GRCm39) missense probably damaging 0.99
R4224:Rnf213 UTSW 11 119,327,649 (GRCm39) nonsense probably null
R4332:Rnf213 UTSW 11 119,327,502 (GRCm39) missense probably damaging 1.00
R4415:Rnf213 UTSW 11 119,374,790 (GRCm39) missense probably damaging 0.99
R4547:Rnf213 UTSW 11 119,370,496 (GRCm39) critical splice donor site probably null
R4609:Rnf213 UTSW 11 119,328,521 (GRCm39) missense possibly damaging 0.86
R4684:Rnf213 UTSW 11 119,331,951 (GRCm39) missense probably damaging 1.00
R4704:Rnf213 UTSW 11 119,331,175 (GRCm39) missense probably damaging 1.00
R4719:Rnf213 UTSW 11 119,310,893 (GRCm39) missense probably benign 0.38
R4751:Rnf213 UTSW 11 119,336,571 (GRCm39) missense probably benign 0.12
R4828:Rnf213 UTSW 11 119,307,455 (GRCm39) missense possibly damaging 0.61
R4837:Rnf213 UTSW 11 119,333,589 (GRCm39) missense probably benign 0.00
R4894:Rnf213 UTSW 11 119,372,066 (GRCm39) missense probably damaging 1.00
R4973:Rnf213 UTSW 11 119,318,983 (GRCm39) missense possibly damaging 0.84
R5026:Rnf213 UTSW 11 119,327,590 (GRCm39) missense probably damaging 1.00
R5034:Rnf213 UTSW 11 119,301,633 (GRCm39) missense probably damaging 0.99
R5284:Rnf213 UTSW 11 119,349,692 (GRCm39) missense possibly damaging 0.89
R5295:Rnf213 UTSW 11 119,331,642 (GRCm39) missense probably benign 0.00
R5406:Rnf213 UTSW 11 119,331,634 (GRCm39) missense probably damaging 1.00
R5441:Rnf213 UTSW 11 119,299,846 (GRCm39) missense probably damaging 0.99
R5449:Rnf213 UTSW 11 119,305,902 (GRCm39) missense probably benign 0.44
R5520:Rnf213 UTSW 11 119,324,325 (GRCm39) missense probably damaging 1.00
R5636:Rnf213 UTSW 11 119,327,731 (GRCm39) missense probably damaging 1.00
R5636:Rnf213 UTSW 11 119,327,455 (GRCm39) missense probably benign 0.04
R5669:Rnf213 UTSW 11 119,349,611 (GRCm39) missense possibly damaging 0.92
R5670:Rnf213 UTSW 11 119,325,512 (GRCm39) critical splice acceptor site probably null
R5697:Rnf213 UTSW 11 119,374,720 (GRCm39) missense possibly damaging 0.54
R5726:Rnf213 UTSW 11 119,307,284 (GRCm39) missense probably damaging 0.99
R5808:Rnf213 UTSW 11 119,327,121 (GRCm39) missense probably benign
R5861:Rnf213 UTSW 11 119,364,203 (GRCm39) missense probably damaging 1.00
R5903:Rnf213 UTSW 11 119,312,195 (GRCm39) missense probably damaging 0.98
R5949:Rnf213 UTSW 11 119,333,905 (GRCm39) missense probably damaging 1.00
R6022:Rnf213 UTSW 11 119,376,836 (GRCm39) missense probably benign 0.00
R6043:Rnf213 UTSW 11 119,332,927 (GRCm39) missense probably damaging 0.97
R6089:Rnf213 UTSW 11 119,307,385 (GRCm39) missense probably benign 0.14
R6123:Rnf213 UTSW 11 119,302,339 (GRCm39) missense probably damaging 0.96
R6134:Rnf213 UTSW 11 119,302,296 (GRCm39) missense probably damaging 0.99
R6135:Rnf213 UTSW 11 119,332,854 (GRCm39) missense probably benign 0.02
R6146:Rnf213 UTSW 11 119,326,825 (GRCm39) missense probably benign 0.41
R6163:Rnf213 UTSW 11 119,349,254 (GRCm39) missense possibly damaging 0.86
R6272:Rnf213 UTSW 11 119,305,374 (GRCm39) missense probably damaging 1.00
R6333:Rnf213 UTSW 11 119,354,192 (GRCm39) missense probably damaging 1.00
R6370:Rnf213 UTSW 11 119,367,904 (GRCm39) missense probably damaging 0.99
R6456:Rnf213 UTSW 11 119,350,792 (GRCm39) missense probably benign 0.03
R6468:Rnf213 UTSW 11 119,343,513 (GRCm39) missense possibly damaging 0.94
R6579:Rnf213 UTSW 11 119,327,106 (GRCm39) missense probably damaging 0.96
R6648:Rnf213 UTSW 11 119,370,746 (GRCm39) missense possibly damaging 0.81
R6727:Rnf213 UTSW 11 119,321,147 (GRCm39) missense possibly damaging 0.77
R6739:Rnf213 UTSW 11 119,333,097 (GRCm39) missense probably damaging 1.00
R6768:Rnf213 UTSW 11 119,333,062 (GRCm39) missense probably damaging 0.99
R6817:Rnf213 UTSW 11 119,353,111 (GRCm39) critical splice donor site probably null
R6820:Rnf213 UTSW 11 119,339,664 (GRCm39) missense probably damaging 1.00
R6841:Rnf213 UTSW 11 119,340,692 (GRCm39) missense probably benign 0.26
R6934:Rnf213 UTSW 11 119,310,893 (GRCm39) missense probably benign 0.38
R7026:Rnf213 UTSW 11 119,370,481 (GRCm39) missense possibly damaging 0.58
R7094:Rnf213 UTSW 11 119,328,430 (GRCm39) splice site probably null
R7170:Rnf213 UTSW 11 119,343,401 (GRCm39) missense
R7185:Rnf213 UTSW 11 119,315,024 (GRCm39) missense
R7239:Rnf213 UTSW 11 119,349,614 (GRCm39) missense
R7258:Rnf213 UTSW 11 119,343,401 (GRCm39) missense
R7259:Rnf213 UTSW 11 119,343,401 (GRCm39) missense
R7260:Rnf213 UTSW 11 119,343,401 (GRCm39) missense
R7273:Rnf213 UTSW 11 119,322,582 (GRCm39) splice site probably null
R7282:Rnf213 UTSW 11 119,328,818 (GRCm39) missense
R7311:Rnf213 UTSW 11 119,307,373 (GRCm39) missense
R7352:Rnf213 UTSW 11 119,334,405 (GRCm39) missense
R7369:Rnf213 UTSW 11 119,321,294 (GRCm39) missense
R7410:Rnf213 UTSW 11 119,325,877 (GRCm39) missense
R7448:Rnf213 UTSW 11 119,372,117 (GRCm39) missense
R7561:Rnf213 UTSW 11 119,332,545 (GRCm39) missense
R7573:Rnf213 UTSW 11 119,349,310 (GRCm39) missense
R7615:Rnf213 UTSW 11 119,358,123 (GRCm39) missense
R7680:Rnf213 UTSW 11 119,370,382 (GRCm39) missense
R7739:Rnf213 UTSW 11 119,301,687 (GRCm39) missense
R7789:Rnf213 UTSW 11 119,361,045 (GRCm39) splice site probably null
R7806:Rnf213 UTSW 11 119,302,371 (GRCm39) missense
R8031:Rnf213 UTSW 11 119,321,107 (GRCm39) nonsense probably null
R8042:Rnf213 UTSW 11 119,332,480 (GRCm39) missense
R8053:Rnf213 UTSW 11 119,293,473 (GRCm39) missense
R8284:Rnf213 UTSW 11 119,318,909 (GRCm39) missense
R8301:Rnf213 UTSW 11 119,325,568 (GRCm39) missense
R8325:Rnf213 UTSW 11 119,321,271 (GRCm39) missense
R8332:Rnf213 UTSW 11 119,374,524 (GRCm39) missense
R8443:Rnf213 UTSW 11 119,340,149 (GRCm39) missense
R8518:Rnf213 UTSW 11 119,353,043 (GRCm39) missense
R8531:Rnf213 UTSW 11 119,365,031 (GRCm39) missense probably benign 0.02
R8670:Rnf213 UTSW 11 119,349,563 (GRCm39) missense
R8675:Rnf213 UTSW 11 119,346,984 (GRCm39) missense
R8690:Rnf213 UTSW 11 119,332,038 (GRCm39) missense
R8690:Rnf213 UTSW 11 119,308,955 (GRCm39) missense
R8714:Rnf213 UTSW 11 119,359,720 (GRCm39) missense
R8802:Rnf213 UTSW 11 119,352,928 (GRCm39) missense
R8861:Rnf213 UTSW 11 119,333,062 (GRCm39) missense
R8886:Rnf213 UTSW 11 119,364,264 (GRCm39) missense
R8893:Rnf213 UTSW 11 119,333,868 (GRCm39) missense
R8937:Rnf213 UTSW 11 119,321,100 (GRCm39) missense possibly damaging 0.94
R8941:Rnf213 UTSW 11 119,305,250 (GRCm39) missense probably damaging 1.00
R8973:Rnf213 UTSW 11 119,352,756 (GRCm39) missense
R8983:Rnf213 UTSW 11 119,321,175 (GRCm39) missense
R9043:Rnf213 UTSW 11 119,349,739 (GRCm39) missense
R9081:Rnf213 UTSW 11 119,357,062 (GRCm39) missense
R9132:Rnf213 UTSW 11 119,374,742 (GRCm39) missense
R9135:Rnf213 UTSW 11 119,299,573 (GRCm39) missense
R9146:Rnf213 UTSW 11 119,334,499 (GRCm39) missense
R9156:Rnf213 UTSW 11 119,331,574 (GRCm39) missense
R9183:Rnf213 UTSW 11 119,318,448 (GRCm39) missense
R9234:Rnf213 UTSW 11 119,340,943 (GRCm39) missense
R9275:Rnf213 UTSW 11 119,326,768 (GRCm39) missense
R9278:Rnf213 UTSW 11 119,326,768 (GRCm39) missense
R9296:Rnf213 UTSW 11 119,334,621 (GRCm39) splice site probably benign
R9350:Rnf213 UTSW 11 119,332,975 (GRCm39) missense
R9366:Rnf213 UTSW 11 119,327,057 (GRCm39) missense
R9413:Rnf213 UTSW 11 119,357,059 (GRCm39) missense
R9444:Rnf213 UTSW 11 119,325,623 (GRCm39) missense
R9464:Rnf213 UTSW 11 119,354,406 (GRCm39) missense
R9605:Rnf213 UTSW 11 119,359,879 (GRCm39) missense
R9649:Rnf213 UTSW 11 119,370,457 (GRCm39) missense
R9651:Rnf213 UTSW 11 119,331,238 (GRCm39) missense
R9664:Rnf213 UTSW 11 119,332,794 (GRCm39) missense
R9696:Rnf213 UTSW 11 119,359,806 (GRCm39) missense
R9710:Rnf213 UTSW 11 119,331,831 (GRCm39) missense
R9797:Rnf213 UTSW 11 119,333,365 (GRCm39) missense
S24628:Rnf213 UTSW 11 119,305,295 (GRCm39) missense probably damaging 1.00
X0021:Rnf213 UTSW 11 119,332,650 (GRCm39) missense probably benign 0.14
X0062:Rnf213 UTSW 11 119,364,339 (GRCm39) missense probably benign 0.05
X0064:Rnf213 UTSW 11 119,331,289 (GRCm39) missense probably damaging 1.00
Z1088:Rnf213 UTSW 11 119,368,080 (GRCm39) missense possibly damaging 0.69
Z1176:Rnf213 UTSW 11 119,373,824 (GRCm39) missense
Z1176:Rnf213 UTSW 11 119,332,236 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- TCTTCAGCATAGACATCCTGGG -3'
(R):5'- TCCTTTGTGGAAAGCACTGGAC -3'

Sequencing Primer
(F):5'- CTGCGGGCTTTACCAGAAATGTC -3'
(R):5'- CTCACAGGAGTCTCAGGATTC -3'
Posted On 2015-04-30