Incidental Mutation 'R4049:Rai14'
ID314062
Institutional Source Beutler Lab
Gene Symbol Rai14
Ensembl Gene ENSMUSG00000022246
Gene Nameretinoic acid induced 14
Synonyms1700008J19Rik, 1700020L11Rik, Ankycorbin, Norpeg
MMRRC Submission 041616-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.705) question?
Stock #R4049 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location10568969-10714624 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 10592212 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 199 (N199S)
Ref Sequence ENSEMBL: ENSMUSP00000153969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090339] [ENSMUST00000169385] [ENSMUST00000227506]
Predicted Effect probably benign
Transcript: ENSMUST00000090339
AA Change: N199S

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000087815
Gene: ENSMUSG00000022246
AA Change: N199S

DomainStartEndE-ValueType
Blast:ANK 18 48 4e-10 BLAST
ANK 52 81 1.66e-6 SMART
ANK 85 117 7.02e-5 SMART
ANK 118 147 2.1e-3 SMART
ANK 151 180 2.16e-5 SMART
ANK 184 213 2.85e-5 SMART
ANK 217 247 9.33e2 SMART
low complexity region 343 357 N/A INTRINSIC
Blast:HAMP 595 646 6e-19 BLAST
low complexity region 897 931 N/A INTRINSIC
Blast:ANK 944 977 6e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000169385
AA Change: N199S

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000126325
Gene: ENSMUSG00000022246
AA Change: N199S

DomainStartEndE-ValueType
Blast:ANK 18 48 4e-10 BLAST
ANK 52 81 1.66e-6 SMART
ANK 85 117 7.02e-5 SMART
ANK 118 147 2.1e-3 SMART
ANK 151 180 2.16e-5 SMART
ANK 184 213 2.85e-5 SMART
ANK 217 247 9.33e2 SMART
low complexity region 343 357 N/A INTRINSIC
Blast:HAMP 595 646 6e-19 BLAST
low complexity region 897 931 N/A INTRINSIC
Blast:ANK 944 977 6e-13 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226530
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226737
Predicted Effect probably benign
Transcript: ENSMUST00000227506
AA Change: N199S

PolyPhen 2 Score 0.299 (Sensitivity: 0.91; Specificity: 0.89)
Meta Mutation Damage Score 0.026 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T A 12: 118,868,669 E1190V probably damaging Het
Arhgef10 A G 8: 14,979,998 T928A probably benign Het
Arhgef10l T A 4: 140,515,451 I836F probably benign Het
Blm T A 7: 80,502,862 T446S probably benign Het
Ccdc63 T A 5: 122,122,750 Q237L probably damaging Het
Cep57l1 G T 10: 41,729,360 R130S probably damaging Het
Clstn2 T G 9: 97,457,560 E786A possibly damaging Het
Col16a1 C T 4: 130,068,752 P540L probably damaging Het
Csf2 A G 11: 54,249,333 F61L probably damaging Het
Ctr9 C T 7: 111,055,543 R1094C unknown Het
Cyp3a41a A G 5: 145,713,540 C98R probably damaging Het
Dthd1 T A 5: 62,827,165 C404* probably null Het
Egfem1 A C 3: 29,686,731 H518P probably benign Het
Elf3 T C 1: 135,254,277 S369G probably benign Het
Eml6 C T 11: 29,838,577 V503M probably damaging Het
Enthd1 T C 15: 80,560,039 D105G probably damaging Het
Eral1 A G 11: 78,075,602 L250P probably damaging Het
Gdf15 A T 8: 70,629,955 M167K probably benign Het
Ggps1 T C 13: 14,053,699 K300E probably benign Het
Gm8074 G A 9: 78,322,336 noncoding transcript Het
Herc3 A G 6: 58,876,837 I623V probably damaging Het
Mad1l1 A G 5: 140,132,816 S457P probably damaging Het
Map1lc3a G T 2: 155,277,542 V91F possibly damaging Het
Map4k3 A G 17: 80,605,965 V617A probably benign Het
Mov10l1 T A 15: 88,995,032 probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Ncor1 G T 11: 62,329,668 probably null Het
Nfe2 C T 15: 103,250,937 E36K possibly damaging Het
Olfr1176 T C 2: 88,343,800 probably null Het
Olfr1212 A G 2: 88,959,273 K269R probably benign Het
Olfr1251 T C 2: 89,667,662 I75V probably benign Het
Olfr653 T C 7: 104,580,368 F241L probably benign Het
Oprm1 G A 10: 6,829,087 V95I probably benign Het
Pcdha9 T A 18: 36,997,942 H21Q probably benign Het
Pcolce2 A T 9: 95,638,755 I62F probably damaging Het
Pfpl T A 19: 12,429,689 C435S probably damaging Het
Pkhd1l1 G A 15: 44,498,557 C542Y probably damaging Het
Plekha5 T C 6: 140,583,871 S75P probably damaging Het
Pphln1 C A 15: 93,465,106 A202E probably damaging Het
Ppp1r1a A G 15: 103,532,454 L92P probably damaging Het
Prokr2 T C 2: 132,381,494 T43A probably benign Het
Rasgrp2 T C 19: 6,404,727 L199P probably damaging Het
Rnf213 A C 11: 119,482,448 M4939L possibly damaging Het
Slc23a2 C T 2: 132,060,683 R533Q probably benign Het
Slc7a7 T C 14: 54,373,091 probably null Het
Snrpd2 T A 7: 19,151,307 V31E probably damaging Het
Spire1 G T 18: 67,529,031 probably null Het
Srsf4 T C 4: 131,900,543 probably benign Het
Tcf20 A G 15: 82,853,429 S1274P probably damaging Het
Tcof1 C A 18: 60,832,903 A376S possibly damaging Het
Thsd1 T A 8: 22,243,164 Y76N possibly damaging Het
Timm44 A G 8: 4,260,561 V397A probably benign Het
Tmc6 G A 11: 117,778,261 T89I possibly damaging Het
Trbv31 C A 6: 41,557,705 C107F probably damaging Het
Trim37 T A 11: 87,140,603 probably null Het
Ttll5 T C 12: 86,012,799 V1226A probably benign Het
Ube3b T C 5: 114,412,870 V865A probably benign Het
Vmn2r86 A T 10: 130,447,097 M550K probably damaging Het
Vps54 C A 11: 21,300,183 T373N probably benign Het
Wdr64 T G 1: 175,805,856 I891S probably benign Het
Wisp2 A G 2: 163,828,984 D137G probably damaging Het
Zfhx4 C T 3: 5,398,859 S1384L probably damaging Het
Zfp703 A G 8: 26,979,085 E259G possibly damaging Het
Zfp933 T C 4: 147,826,512 H209R probably damaging Het
Zfp980 A G 4: 145,702,600 H633R probably damaging Het
Other mutations in Rai14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Rai14 APN 15 10599711 splice site probably benign
IGL01625:Rai14 APN 15 10572374 missense probably benign 0.30
IGL01925:Rai14 APN 15 10595862 missense possibly damaging 0.88
IGL02053:Rai14 APN 15 10633156 missense probably benign 0.00
IGL02531:Rai14 APN 15 10574782 missense probably damaging 1.00
IGL02748:Rai14 APN 15 10589335 missense probably benign 0.14
IGL02945:Rai14 APN 15 10574709 missense probably benign 0.00
PIT4618001:Rai14 UTSW 15 10575156 missense probably damaging 1.00
R1400:Rai14 UTSW 15 10571548 missense probably damaging 0.98
R1583:Rai14 UTSW 15 10587916 missense probably damaging 1.00
R1686:Rai14 UTSW 15 10592196 missense probably damaging 0.98
R1721:Rai14 UTSW 15 10633228 missense probably damaging 1.00
R1867:Rai14 UTSW 15 10633228 missense probably damaging 1.00
R1868:Rai14 UTSW 15 10633228 missense probably damaging 1.00
R1998:Rai14 UTSW 15 10594981 splice site probably null
R2118:Rai14 UTSW 15 10575166 missense probably benign 0.00
R3161:Rai14 UTSW 15 10633164 missense possibly damaging 0.74
R3162:Rai14 UTSW 15 10633164 missense possibly damaging 0.74
R3162:Rai14 UTSW 15 10633164 missense possibly damaging 0.74
R4611:Rai14 UTSW 15 10592138 missense probably damaging 1.00
R4760:Rai14 UTSW 15 10575690 missense possibly damaging 0.60
R4863:Rai14 UTSW 15 10572470 missense probably damaging 0.99
R5022:Rai14 UTSW 15 10574506 missense probably damaging 0.96
R5110:Rai14 UTSW 15 10690410 start gained probably benign
R5410:Rai14 UTSW 15 10574938 missense probably damaging 1.00
R5643:Rai14 UTSW 15 10593051 missense probably benign 0.03
R5644:Rai14 UTSW 15 10593051 missense probably benign 0.03
R5681:Rai14 UTSW 15 10575120 missense probably damaging 1.00
R5934:Rai14 UTSW 15 10575159 missense probably damaging 0.98
R6333:Rai14 UTSW 15 10574936 nonsense probably null
R6338:Rai14 UTSW 15 10574976 missense probably damaging 1.00
R6864:Rai14 UTSW 15 10633168 missense possibly damaging 0.95
R7015:Rai14 UTSW 15 10589315 nonsense probably null
R7155:Rai14 UTSW 15 10595003 missense possibly damaging 0.53
R7480:Rai14 UTSW 15 10571536 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CACAAATTCCTTTATCCTTTTGGGG -3'
(R):5'- GAAGACTGACTGCTATTTGGTG -3'

Sequencing Primer
(F):5'- GTGGATGAATTAAAAATAACCTCGGC -3'
(R):5'- AATACCACCTTATTTCGTCTTGACAG -3'
Posted On2015-04-30