Incidental Mutation 'R4050:Ncbp1'
ID314095
Institutional Source Beutler Lab
Gene Symbol Ncbp1
Ensembl Gene ENSMUSG00000028330
Gene Namenuclear cap binding protein subunit 1
Synonyms
MMRRC Submission 040968-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4050 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location46138613-46172403 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 46147483 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 110 (R110H)
Ref Sequence ENSEMBL: ENSMUSP00000030014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030014]
PDB Structure
Mouse importin alpha: mouse CBP80 cNLS complex [X-RAY DIFFRACTION]
Mouse importin alpha: mouse CBP80Y8D cNLS complex [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000030014
AA Change: R110H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000030014
Gene: ENSMUSG00000028330
AA Change: R110H

DomainStartEndE-ValueType
MIF4G 28 240 1.33e-38 SMART
Pfam:MIF4G_like 309 471 1.4e-37 PFAM
Pfam:MIF4G_like_2 485 754 4e-78 PFAM
Meta Mutation Damage Score 0.324 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a component of the nuclear cap-binding protein complex (CBC), which binds to the monomethylated 5' cap of nascent pre-mRNA in the nucleoplasm. The encoded protein promotes high-affinity mRNA-cap binding and associates with the CTD of RNA polymerase II. The CBC promotes pre-mRNA splicing, 3'-end processing, RNA nuclear export, and nonsense-mediated mRNA decay. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik A G 4: 147,944,992 D473G probably damaging Het
9530053A07Rik T C 7: 28,152,985 V1311A possibly damaging Het
Abca1 T A 4: 53,044,144 Q1826L probably damaging Het
Apob G A 12: 8,015,390 V4087I probably benign Het
Atp10b G A 11: 43,259,536 A1354T probably benign Het
Baz1a A G 12: 54,929,619 V424A probably benign Het
Cdc20b G A 13: 113,064,285 D180N probably benign Het
Cep57l1 G T 10: 41,729,360 R130S probably damaging Het
Ddb1 A G 19: 10,627,807 D1053G probably benign Het
Ddx39 T A 8: 83,722,234 M246K probably benign Het
Dip2a G A 10: 76,278,607 T1013M probably damaging Het
Edar G T 10: 58,609,947 T265N possibly damaging Het
Fam207a T C 10: 77,514,330 R75G possibly damaging Het
Fam208b A G 13: 3,573,507 S2148P probably benign Het
Gbp8 T A 5: 105,031,238 I132F probably damaging Het
Gga1 A G 15: 78,891,491 D382G probably benign Het
Ggps1 T C 13: 14,053,699 K300E probably benign Het
Gm10518 C A 1: 179,803,813 probably benign Het
Gm13078 T C 4: 143,727,122 S267P probably benign Het
Gm8074 G A 9: 78,322,336 noncoding transcript Het
H2-Eb1 T A 17: 34,314,368 L188Q probably damaging Het
Heatr6 A G 11: 83,755,773 S95G probably damaging Het
Hnf1a T A 5: 114,970,574 N91Y probably damaging Het
Ints10 C T 8: 68,827,351 S710F probably damaging Het
Kazn C T 4: 142,106,904 E614K unknown Het
Kif26a T A 12: 112,179,916 M1812K probably benign Het
Lmo7 A T 14: 101,902,277 K488* probably null Het
Mad1l1 A G 5: 140,132,816 S457P probably damaging Het
Met A G 6: 17,533,984 T645A probably benign Het
Mpp4 T C 1: 59,146,744 probably null Het
Mycl A T 4: 122,996,839 probably null Het
Nfasc G T 1: 132,610,305 probably benign Het
Nup35 A G 2: 80,655,976 I212V probably benign Het
Olfr1181 A G 2: 88,423,623 M134T probably damaging Het
Olfr1373 T G 11: 52,145,134 Y132S probably damaging Het
Ovgp1 A G 3: 105,986,596 probably benign Het
Ovgp1 T C 3: 105,986,567 probably benign Het
Pcgf5 G A 19: 36,442,911 S181N probably damaging Het
Plk2 C T 13: 110,399,866 T617I probably damaging Het
Polq A T 16: 37,092,820 probably null Het
Ppp1r1a A G 15: 103,532,454 L92P probably damaging Het
Prg4 G C 1: 150,454,759 probably benign Het
Prune1 T C 3: 95,262,231 K220R possibly damaging Het
Rab3gap2 G A 1: 185,272,643 probably null Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sall3 G A 18: 80,971,482 A1005V probably benign Het
Samd15 T G 12: 87,200,632 N30K probably benign Het
Scn8a A T 15: 101,013,413 K905* probably null Het
Scrib G A 15: 76,051,473 R1245W possibly damaging Het
Skint4 C T 4: 112,124,614 S260L probably benign Het
Slc29a2 A T 19: 5,029,453 M339L possibly damaging Het
Spire1 G T 18: 67,529,031 probably null Het
Synpo2 T C 3: 123,114,278 D463G possibly damaging Het
Taf4 C A 2: 179,932,012 G688C probably damaging Het
Tpte T A 8: 22,365,984 V600E probably damaging Het
Ttn A G 2: 76,821,166 V10953A probably benign Het
Vav2 T C 2: 27,288,679 Y333C probably benign Het
Vav2 A G 2: 27,291,403 S311P probably damaging Het
Zbtb26 A C 2: 37,436,988 M1R probably null Het
Zfp26 G A 9: 20,442,229 P88L probably benign Het
Zfp324 T C 7: 12,970,867 F328L probably damaging Het
Other mutations in Ncbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00840:Ncbp1 APN 4 46161307 missense probably damaging 1.00
IGL02085:Ncbp1 APN 4 46159699 missense probably damaging 0.96
IGL02230:Ncbp1 APN 4 46165272 missense probably benign 0.03
IGL02561:Ncbp1 APN 4 46159711 missense possibly damaging 0.80
IGL02574:Ncbp1 APN 4 46168449 critical splice acceptor site probably null
IGL03371:Ncbp1 APN 4 46171991 nonsense probably null
R0549:Ncbp1 UTSW 4 46168476 missense possibly damaging 0.69
R0594:Ncbp1 UTSW 4 46170551 missense probably benign 0.00
R0699:Ncbp1 UTSW 4 46147528 missense probably benign 0.17
R0725:Ncbp1 UTSW 4 46152056 missense probably benign 0.01
R0961:Ncbp1 UTSW 4 46165193 missense possibly damaging 0.69
R1330:Ncbp1 UTSW 4 46167354 missense probably benign 0.19
R1622:Ncbp1 UTSW 4 46171963 missense possibly damaging 0.60
R1756:Ncbp1 UTSW 4 46169131 nonsense probably null
R2417:Ncbp1 UTSW 4 46168530 missense probably benign 0.20
R4132:Ncbp1 UTSW 4 46169241 nonsense probably null
R4516:Ncbp1 UTSW 4 46157824 missense probably damaging 1.00
R4795:Ncbp1 UTSW 4 46152967 missense possibly damaging 0.83
R4796:Ncbp1 UTSW 4 46152967 missense possibly damaging 0.83
R4960:Ncbp1 UTSW 4 46165273 nonsense probably null
R5557:Ncbp1 UTSW 4 46165259 missense probably benign 0.01
R5626:Ncbp1 UTSW 4 46161290 missense probably damaging 1.00
R5682:Ncbp1 UTSW 4 46170474 unclassified probably benign
R5859:Ncbp1 UTSW 4 46163026 missense probably benign 0.00
R6377:Ncbp1 UTSW 4 46150703 missense probably damaging 1.00
R6440:Ncbp1 UTSW 4 46147516 missense probably damaging 1.00
R6793:Ncbp1 UTSW 4 46157827 missense probably damaging 0.99
R7078:Ncbp1 UTSW 4 46155756 missense probably benign 0.00
X0013:Ncbp1 UTSW 4 46150702 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGTATCTGCACACTGCCCAG -3'
(R):5'- CAGGAATTTCAGGACTTGCAG -3'

Sequencing Primer
(F):5'- ACTGCCCAGTGATGCTGTGTC -3'
(R):5'- CAGGACTTGCAGTAGTTTTTTCCTTC -3'
Posted On2015-04-30