Incidental Mutation 'R4050:Mad1l1'
ID314103
Institutional Source Beutler Lab
Gene Symbol Mad1l1
Ensembl Gene ENSMUSG00000029554
Gene NameMAD1 mitotic arrest deficient 1-like 1
SynonymsMad1
MMRRC Submission 040968-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4050 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location140008689-140321552 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 140132816 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 457 (S457P)
Ref Sequence ENSEMBL: ENSMUSP00000106453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031534] [ENSMUST00000110829]
Predicted Effect probably damaging
Transcript: ENSMUST00000031534
AA Change: S457P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031534
Gene: ENSMUSG00000029554
AA Change: S457P

DomainStartEndE-ValueType
Pfam:MAD 54 715 1.6e-272 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110829
AA Change: S457P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106453
Gene: ENSMUSG00000029554
AA Change: S457P

DomainStartEndE-ValueType
Pfam:MAD 2 511 2.5e-198 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199237
Meta Mutation Damage Score 0.232 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MAD1L1 is a component of the mitotic spindle-assembly checkpoint that prevents the onset of anaphase until all chromosome are properly aligned at the metaphase plate. MAD1L1 functions as a homodimer and interacts with MAD2L1. MAD1L1 may play a role in cell cycle control and tumor suppression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a null allele die in utero. Aging heterozygous null mice show increased tumor incidence while heterozygous MEFs are more prone to aneuploidy, induce fibrosarcomas in athymic nude mice, and show a weaker spindle assembly checkpoint-mediated arrest n response to nocodazole. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik A G 4: 147,944,992 D473G probably damaging Het
9530053A07Rik T C 7: 28,152,985 V1311A possibly damaging Het
Abca1 T A 4: 53,044,144 Q1826L probably damaging Het
Apob G A 12: 8,015,390 V4087I probably benign Het
Atp10b G A 11: 43,259,536 A1354T probably benign Het
Baz1a A G 12: 54,929,619 V424A probably benign Het
Cdc20b G A 13: 113,064,285 D180N probably benign Het
Cep57l1 G T 10: 41,729,360 R130S probably damaging Het
Ddb1 A G 19: 10,627,807 D1053G probably benign Het
Ddx39 T A 8: 83,722,234 M246K probably benign Het
Dip2a G A 10: 76,278,607 T1013M probably damaging Het
Edar G T 10: 58,609,947 T265N possibly damaging Het
Fam207a T C 10: 77,514,330 R75G possibly damaging Het
Fam208b A G 13: 3,573,507 S2148P probably benign Het
Gbp8 T A 5: 105,031,238 I132F probably damaging Het
Gga1 A G 15: 78,891,491 D382G probably benign Het
Ggps1 T C 13: 14,053,699 K300E probably benign Het
Gm10518 C A 1: 179,803,813 probably benign Het
Gm13078 T C 4: 143,727,122 S267P probably benign Het
Gm8074 G A 9: 78,322,336 noncoding transcript Het
H2-Eb1 T A 17: 34,314,368 L188Q probably damaging Het
Heatr6 A G 11: 83,755,773 S95G probably damaging Het
Hnf1a T A 5: 114,970,574 N91Y probably damaging Het
Ints10 C T 8: 68,827,351 S710F probably damaging Het
Kazn C T 4: 142,106,904 E614K unknown Het
Kif26a T A 12: 112,179,916 M1812K probably benign Het
Lmo7 A T 14: 101,902,277 K488* probably null Het
Met A G 6: 17,533,984 T645A probably benign Het
Mpp4 T C 1: 59,146,744 probably null Het
Mycl A T 4: 122,996,839 probably null Het
Ncbp1 G A 4: 46,147,483 R110H probably damaging Het
Nfasc G T 1: 132,610,305 probably benign Het
Nup35 A G 2: 80,655,976 I212V probably benign Het
Olfr1181 A G 2: 88,423,623 M134T probably damaging Het
Olfr1373 T G 11: 52,145,134 Y132S probably damaging Het
Ovgp1 A G 3: 105,986,596 probably benign Het
Ovgp1 T C 3: 105,986,567 probably benign Het
Pcgf5 G A 19: 36,442,911 S181N probably damaging Het
Plk2 C T 13: 110,399,866 T617I probably damaging Het
Polq A T 16: 37,092,820 probably null Het
Ppp1r1a A G 15: 103,532,454 L92P probably damaging Het
Prg4 G C 1: 150,454,759 probably benign Het
Prune1 T C 3: 95,262,231 K220R possibly damaging Het
Rab3gap2 G A 1: 185,272,643 probably null Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sall3 G A 18: 80,971,482 A1005V probably benign Het
Samd15 T G 12: 87,200,632 N30K probably benign Het
Scn8a A T 15: 101,013,413 K905* probably null Het
Scrib G A 15: 76,051,473 R1245W possibly damaging Het
Skint4 C T 4: 112,124,614 S260L probably benign Het
Slc29a2 A T 19: 5,029,453 M339L possibly damaging Het
Spire1 G T 18: 67,529,031 probably null Het
Synpo2 T C 3: 123,114,278 D463G possibly damaging Het
Taf4 C A 2: 179,932,012 G688C probably damaging Het
Tpte T A 8: 22,365,984 V600E probably damaging Het
Ttn A G 2: 76,821,166 V10953A probably benign Het
Vav2 T C 2: 27,288,679 Y333C probably benign Het
Vav2 A G 2: 27,291,403 S311P probably damaging Het
Zbtb26 A C 2: 37,436,988 M1R probably null Het
Zfp26 G A 9: 20,442,229 P88L probably benign Het
Zfp324 T C 7: 12,970,867 F328L probably damaging Het
Other mutations in Mad1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01570:Mad1l1 APN 5 140117277 missense probably benign 0.00
IGL02098:Mad1l1 APN 5 140310589 splice site probably benign
IGL02100:Mad1l1 APN 5 140143934 missense probably damaging 1.00
IGL03131:Mad1l1 APN 5 140307703 missense probably benign 0.18
R0738:Mad1l1 UTSW 5 140300560 missense probably damaging 1.00
R1902:Mad1l1 UTSW 5 140303688 missense possibly damaging 0.57
R1989:Mad1l1 UTSW 5 140303670 missense probably benign 0.27
R2090:Mad1l1 UTSW 5 140009256 missense probably benign 0.01
R2471:Mad1l1 UTSW 5 140261552 missense probably benign 0.43
R4049:Mad1l1 UTSW 5 140132816 missense probably damaging 1.00
R4096:Mad1l1 UTSW 5 140307673 missense probably benign 0.01
R4682:Mad1l1 UTSW 5 140300252 missense possibly damaging 0.47
R4729:Mad1l1 UTSW 5 140261511 missense possibly damaging 0.76
R4838:Mad1l1 UTSW 5 140300262 nonsense probably null
R5946:Mad1l1 UTSW 5 140261579 missense probably damaging 1.00
R6088:Mad1l1 UTSW 5 140193963 missense probably benign 0.13
R6362:Mad1l1 UTSW 5 140315055 missense possibly damaging 0.71
R6845:Mad1l1 UTSW 5 140009169 missense probably damaging 1.00
R6957:Mad1l1 UTSW 5 140065817 missense probably damaging 0.99
R6983:Mad1l1 UTSW 5 140193984 missense probably damaging 0.99
R7347:Mad1l1 UTSW 5 140144044 missense probably damaging 1.00
U24488:Mad1l1 UTSW 5 140315085 missense probably damaging 1.00
X0026:Mad1l1 UTSW 5 140009205 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGAGCGTATGCCTGAAG -3'
(R):5'- ACTAGGATGCAAGATTCAGCTGG -3'

Sequencing Primer
(F):5'- TGAAGGCCAAGTCCTACTGG -3'
(R):5'- GCCCTAACTTGCCCCAGTG -3'
Posted On2015-04-30