Incidental Mutation 'R4050:Polq'
ID314135
Institutional Source Beutler Lab
Gene Symbol Polq
Ensembl Gene ENSMUSG00000034206
Gene Namepolymerase (DNA directed), theta
SynonymsA430110D14Rik
MMRRC Submission 040968-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.329) question?
Stock #R4050 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location37011786-37095417 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 37092820 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000071396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054034] [ENSMUST00000071452] [ENSMUST00000182946] [ENSMUST00000183112]
Predicted Effect probably null
Transcript: ENSMUST00000054034
SMART Domains Protein: ENSMUSP00000059757
Gene: ENSMUSG00000034206

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
DEXDc 87 298 4.09e-18 SMART
HELICc 398 484 4.02e-17 SMART
Blast:DEXDc 485 550 2e-25 BLAST
low complexity region 609 626 N/A INTRINSIC
PDB:2ZJA|A 712 826 5e-9 PDB
low complexity region 845 852 N/A INTRINSIC
low complexity region 898 911 N/A INTRINSIC
low complexity region 1126 1149 N/A INTRINSIC
low complexity region 1813 1822 N/A INTRINSIC
POLAc 2265 2504 3.3e-101 SMART
low complexity region 2521 2531 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000071452
SMART Domains Protein: ENSMUSP00000071396
Gene: ENSMUSG00000034206

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
Pfam:DEAD 92 216 5.9e-12 PFAM
low complexity region 330 347 N/A INTRINSIC
PDB:2ZJA|A 433 547 5e-9 PDB
low complexity region 566 573 N/A INTRINSIC
low complexity region 619 632 N/A INTRINSIC
low complexity region 847 870 N/A INTRINSIC
low complexity region 1534 1543 N/A INTRINSIC
POLAc 1986 2225 3.3e-101 SMART
low complexity region 2242 2252 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182717
Predicted Effect probably benign
Transcript: ENSMUST00000182946
SMART Domains Protein: ENSMUSP00000138685
Gene: ENSMUSG00000034206

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
Pfam:DEAD 92 164 1.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183112
SMART Domains Protein: ENSMUSP00000138648
Gene: ENSMUSG00000034206

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
Pfam:DEAD 92 164 1.3e-9 PFAM
Meta Mutation Damage Score 0.52 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 97% (58/60)
MGI Phenotype PHENOTYPE: Animals carrying a homozygous mutation at this locus display elevated levels of chromosomal damage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik A G 4: 147,944,992 D473G probably damaging Het
9530053A07Rik T C 7: 28,152,985 V1311A possibly damaging Het
Abca1 T A 4: 53,044,144 Q1826L probably damaging Het
Apob G A 12: 8,015,390 V4087I probably benign Het
Atp10b G A 11: 43,259,536 A1354T probably benign Het
Baz1a A G 12: 54,929,619 V424A probably benign Het
Cdc20b G A 13: 113,064,285 D180N probably benign Het
Cep57l1 G T 10: 41,729,360 R130S probably damaging Het
Ddb1 A G 19: 10,627,807 D1053G probably benign Het
Ddx39 T A 8: 83,722,234 M246K probably benign Het
Dip2a G A 10: 76,278,607 T1013M probably damaging Het
Edar G T 10: 58,609,947 T265N possibly damaging Het
Fam207a T C 10: 77,514,330 R75G possibly damaging Het
Fam208b A G 13: 3,573,507 S2148P probably benign Het
Gbp8 T A 5: 105,031,238 I132F probably damaging Het
Gga1 A G 15: 78,891,491 D382G probably benign Het
Ggps1 T C 13: 14,053,699 K300E probably benign Het
Gm10518 C A 1: 179,803,813 probably benign Het
Gm13078 T C 4: 143,727,122 S267P probably benign Het
Gm8074 G A 9: 78,322,336 noncoding transcript Het
H2-Eb1 T A 17: 34,314,368 L188Q probably damaging Het
Heatr6 A G 11: 83,755,773 S95G probably damaging Het
Hnf1a T A 5: 114,970,574 N91Y probably damaging Het
Ints10 C T 8: 68,827,351 S710F probably damaging Het
Kazn C T 4: 142,106,904 E614K unknown Het
Kif26a T A 12: 112,179,916 M1812K probably benign Het
Lmo7 A T 14: 101,902,277 K488* probably null Het
Mad1l1 A G 5: 140,132,816 S457P probably damaging Het
Met A G 6: 17,533,984 T645A probably benign Het
Mpp4 T C 1: 59,146,744 probably null Het
Mycl A T 4: 122,996,839 probably null Het
Ncbp1 G A 4: 46,147,483 R110H probably damaging Het
Nfasc G T 1: 132,610,305 probably benign Het
Nup35 A G 2: 80,655,976 I212V probably benign Het
Olfr1181 A G 2: 88,423,623 M134T probably damaging Het
Olfr1373 T G 11: 52,145,134 Y132S probably damaging Het
Ovgp1 A G 3: 105,986,596 probably benign Het
Ovgp1 T C 3: 105,986,567 probably benign Het
Pcgf5 G A 19: 36,442,911 S181N probably damaging Het
Plk2 C T 13: 110,399,866 T617I probably damaging Het
Ppp1r1a A G 15: 103,532,454 L92P probably damaging Het
Prg4 G C 1: 150,454,759 probably benign Het
Prune1 T C 3: 95,262,231 K220R possibly damaging Het
Rab3gap2 G A 1: 185,272,643 probably null Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sall3 G A 18: 80,971,482 A1005V probably benign Het
Samd15 T G 12: 87,200,632 N30K probably benign Het
Scn8a A T 15: 101,013,413 K905* probably null Het
Scrib G A 15: 76,051,473 R1245W possibly damaging Het
Skint4 C T 4: 112,124,614 S260L probably benign Het
Slc29a2 A T 19: 5,029,453 M339L possibly damaging Het
Spire1 G T 18: 67,529,031 probably null Het
Synpo2 T C 3: 123,114,278 D463G possibly damaging Het
Taf4 C A 2: 179,932,012 G688C probably damaging Het
Tpte T A 8: 22,365,984 V600E probably damaging Het
Ttn A G 2: 76,821,166 V10953A probably benign Het
Vav2 T C 2: 27,288,679 Y333C probably benign Het
Vav2 A G 2: 27,291,403 S311P probably damaging Het
Zbtb26 A C 2: 37,436,988 M1R probably null Het
Zfp26 G A 9: 20,442,229 P88L probably benign Het
Zfp324 T C 7: 12,970,867 F328L probably damaging Het
Other mutations in Polq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Polq APN 16 37065247 splice site probably benign
IGL00539:Polq APN 16 37060569 missense probably damaging 0.98
IGL00960:Polq APN 16 37060512 missense probably damaging 0.96
IGL01100:Polq APN 16 37061112 missense probably benign
IGL01112:Polq APN 16 37017309 missense probably damaging 1.00
IGL01138:Polq APN 16 37045869 missense possibly damaging 0.94
IGL01432:Polq APN 16 37071822 splice site probably benign
IGL01522:Polq APN 16 37027903 missense probably damaging 1.00
IGL01565:Polq APN 16 37013113 missense probably benign 0.00
IGL01592:Polq APN 16 37034850 missense probably benign 0.01
IGL01690:Polq APN 16 37062838 missense probably damaging 0.97
IGL01943:Polq APN 16 37061443 missense possibly damaging 0.47
IGL02531:Polq APN 16 37062374 missense possibly damaging 0.75
IGL02553:Polq APN 16 37041768 missense probably damaging 1.00
IGL02623:Polq APN 16 37060375 missense probably benign 0.04
IGL02692:Polq APN 16 37060627 missense probably damaging 1.00
IGL02717:Polq APN 16 37022740 missense probably damaging 1.00
IGL02937:Polq APN 16 37013109 missense probably benign 0.14
IGL02959:Polq APN 16 37086566 missense probably damaging 1.00
IGL03086:Polq APN 16 37091049 missense probably benign 0.02
IGL03141:Polq APN 16 37017358 splice site probably benign
IGL03302:Polq APN 16 37071772 missense probably damaging 1.00
IGL03393:Polq APN 16 37044794 missense probably damaging 1.00
PIT4403001:Polq UTSW 16 37060587 missense probably benign 0.00
R0013:Polq UTSW 16 37061839 missense possibly damaging 0.56
R0082:Polq UTSW 16 37017257 missense probably benign 0.01
R0212:Polq UTSW 16 37066854 missense probably damaging 0.99
R0387:Polq UTSW 16 37029430 missense probably damaging 1.00
R0387:Polq UTSW 16 37089317 missense probably damaging 1.00
R0427:Polq UTSW 16 37061993 nonsense probably null
R0454:Polq UTSW 16 37034890 missense probably damaging 0.98
R0513:Polq UTSW 16 37094502 missense probably damaging 1.00
R0622:Polq UTSW 16 37060993 missense probably benign 0.02
R0848:Polq UTSW 16 37062130 missense probably benign 0.08
R1142:Polq UTSW 16 37013217 missense probably damaging 0.98
R1218:Polq UTSW 16 37029446 missense possibly damaging 0.93
R1331:Polq UTSW 16 37041747 missense probably damaging 1.00
R1398:Polq UTSW 16 37062495 missense possibly damaging 0.87
R1424:Polq UTSW 16 37086528 missense probably damaging 1.00
R1644:Polq UTSW 16 37060264 missense probably damaging 0.96
R1777:Polq UTSW 16 37060224 missense possibly damaging 0.94
R1820:Polq UTSW 16 37029418 missense possibly damaging 0.48
R1854:Polq UTSW 16 37062109 missense probably benign 0.01
R1880:Polq UTSW 16 37086592 missense possibly damaging 0.90
R1932:Polq UTSW 16 37062304 missense possibly damaging 0.92
R2008:Polq UTSW 16 37062482 missense probably damaging 0.96
R2014:Polq UTSW 16 37078366 missense probably damaging 1.00
R2026:Polq UTSW 16 37062745 missense possibly damaging 0.93
R2178:Polq UTSW 16 37062829 missense probably damaging 1.00
R2259:Polq UTSW 16 37062097 missense probably benign 0.03
R2266:Polq UTSW 16 37062153 missense possibly damaging 0.59
R2305:Polq UTSW 16 37062337 missense probably damaging 0.99
R2370:Polq UTSW 16 37073939 missense probably damaging 1.00
R2504:Polq UTSW 16 37011942 missense unknown
R2517:Polq UTSW 16 37089325 missense probably damaging 1.00
R2697:Polq UTSW 16 37042153 missense probably damaging 1.00
R2858:Polq UTSW 16 37062753 missense possibly damaging 0.88
R3436:Polq UTSW 16 37062337 missense probably damaging 0.99
R3437:Polq UTSW 16 37062337 missense probably damaging 0.99
R3699:Polq UTSW 16 37042156 missense probably damaging 1.00
R3838:Polq UTSW 16 37078349 missense probably damaging 1.00
R3875:Polq UTSW 16 37074027 missense probably damaging 0.99
R4172:Polq UTSW 16 37060758 missense probably benign 0.02
R4238:Polq UTSW 16 37013181 missense probably damaging 1.00
R4240:Polq UTSW 16 37013181 missense probably damaging 1.00
R4280:Polq UTSW 16 37082057 missense probably damaging 1.00
R4296:Polq UTSW 16 37061301 missense possibly damaging 0.94
R4360:Polq UTSW 16 37060339 missense probably benign 0.00
R4373:Polq UTSW 16 37013181 missense probably damaging 1.00
R4375:Polq UTSW 16 37013181 missense probably damaging 1.00
R4376:Polq UTSW 16 37013181 missense probably damaging 1.00
R4509:Polq UTSW 16 37048563 missense probably damaging 1.00
R4510:Polq UTSW 16 37048563 missense probably damaging 1.00
R4511:Polq UTSW 16 37048563 missense probably damaging 1.00
R4543:Polq UTSW 16 37060785 missense probably benign 0.43
R4633:Polq UTSW 16 37048542 missense probably damaging 1.00
R4739:Polq UTSW 16 37041747 missense probably damaging 1.00
R4834:Polq UTSW 16 37027814 missense probably damaging 1.00
R4841:Polq UTSW 16 37048783 critical splice donor site probably null
R4842:Polq UTSW 16 37048783 critical splice donor site probably null
R4937:Polq UTSW 16 37027912 missense probably benign 0.01
R4955:Polq UTSW 16 37061082 missense probably benign 0.32
R4992:Polq UTSW 16 37061162 missense possibly damaging 0.59
R5008:Polq UTSW 16 37062387 missense probably benign
R5221:Polq UTSW 16 37042178 missense probably damaging 0.98
R5254:Polq UTSW 16 37089319 missense probably damaging 1.00
R5292:Polq UTSW 16 37061383 missense probably damaging 1.00
R5375:Polq UTSW 16 37082784 missense probably damaging 1.00
R5480:Polq UTSW 16 37013290 splice site probably benign
R5552:Polq UTSW 16 37094510 missense possibly damaging 0.93
R5591:Polq UTSW 16 37011885 utr 5 prime probably benign
R5653:Polq UTSW 16 37040534 missense probably damaging 1.00
R5708:Polq UTSW 16 37061018 missense probably damaging 0.98
R5754:Polq UTSW 16 37017263 missense probably benign
R5757:Polq UTSW 16 37086681 missense probably benign 0.01
R5764:Polq UTSW 16 37017344 missense probably damaging 0.97
R6019:Polq UTSW 16 37061764 missense probably damaging 1.00
R6170:Polq UTSW 16 37045812 missense possibly damaging 0.82
R6177:Polq UTSW 16 37071709 missense probably damaging 0.98
R6307:Polq UTSW 16 37017356 critical splice donor site probably null
R6499:Polq UTSW 16 37060827 missense probably benign 0.03
R6520:Polq UTSW 16 37060377 missense possibly damaging 0.88
R6598:Polq UTSW 16 37061631 missense probably benign 0.39
R6694:Polq UTSW 16 37015173 missense probably null 0.99
R6788:Polq UTSW 16 37077148 missense probably damaging 1.00
R7104:Polq UTSW 16 37089353 nonsense probably null
R7159:Polq UTSW 16 37062853 missense possibly damaging 0.87
R7222:Polq UTSW 16 37086633 nonsense probably null
R7340:Polq UTSW 16 37060926 missense probably benign 0.00
R7361:Polq UTSW 16 37060428 missense probably benign 0.00
R7384:Polq UTSW 16 37029418 missense probably damaging 1.00
X0060:Polq UTSW 16 37017237 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGATCCTTAACTGAACGTTGAAG -3'
(R):5'- TTAGATCTACCAAGCACCTCACTG -3'

Sequencing Primer
(F):5'- CATAGTCTACTCTCATATGGGTGGC -3'
(R):5'- CTGCTATATAGACAAACCTGTTCGG -3'
Posted On2015-04-30