Incidental Mutation 'R0388:Mast1'
ID31414
Institutional Source Beutler Lab
Gene Symbol Mast1
Ensembl Gene ENSMUSG00000053693
Gene Namemicrotubule associated serine/threonine kinase 1
SynonymsSAST170, SAST, 9430008B02Rik
MMRRC Submission 038594-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.486) question?
Stock #R0388 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location84911903-84937359 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 84915537 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 1063 (I1063L)
Ref Sequence ENSEMBL: ENSMUSP00000105363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003910] [ENSMUST00000109741] [ENSMUST00000109744] [ENSMUST00000119820]
Predicted Effect probably benign
Transcript: ENSMUST00000003910
SMART Domains Protein: ENSMUSP00000003910
Gene: ENSMUSG00000003812

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:DNase_II 21 349 5.8e-116 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109741
AA Change: I1063L

PolyPhen 2 Score 0.133 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000105363
Gene: ENSMUSG00000053693
AA Change: I1063L

DomainStartEndE-ValueType
Pfam:DUF1908 61 337 1.4e-136 PFAM
S_TKc 376 649 4.07e-97 SMART
S_TK_X 650 710 6.23e-2 SMART
low complexity region 820 836 N/A INTRINSIC
low complexity region 863 878 N/A INTRINSIC
low complexity region 933 961 N/A INTRINSIC
PDZ 977 1057 3.49e-14 SMART
low complexity region 1104 1132 N/A INTRINSIC
low complexity region 1149 1174 N/A INTRINSIC
low complexity region 1212 1224 N/A INTRINSIC
low complexity region 1243 1252 N/A INTRINSIC
low complexity region 1479 1492 N/A INTRINSIC
low complexity region 1519 1535 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109744
SMART Domains Protein: ENSMUSP00000105366
Gene: ENSMUSG00000003812

DomainStartEndE-ValueType
Pfam:DNase_II 9 328 4.8e-114 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119820
SMART Domains Protein: ENSMUSP00000113547
Gene: ENSMUSG00000053693

DomainStartEndE-ValueType
Pfam:DUF1908 61 338 5.1e-148 PFAM
S_TKc 376 644 2.79e-86 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128400
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135219
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148573
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153000
Meta Mutation Damage Score 0.016 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,295,159 probably benign Het
Acsbg1 T C 9: 54,609,063 K678R probably damaging Het
Adgrg6 A G 10: 14,450,658 I410T probably benign Het
Afap1l2 A C 19: 56,917,242 probably benign Het
Aox2 T C 1: 58,354,406 Y1242H probably damaging Het
Apoo-ps T C 13: 107,414,673 noncoding transcript Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Cdh3 C A 8: 106,539,129 T268K probably damaging Het
Chd5 T A 4: 152,371,644 H923Q probably damaging Het
Chd7 T C 4: 8,854,560 V1967A probably benign Het
Cntn3 T C 6: 102,277,316 M222V probably damaging Het
Dcaf17 A G 2: 71,078,571 K277R probably benign Het
Dmbt1 T C 7: 131,096,049 probably benign Het
Dmpk T A 7: 19,084,077 probably benign Het
Dzank1 A T 2: 144,476,106 L714Q possibly damaging Het
Efcab3 A G 11: 105,109,401 D272G possibly damaging Het
Erbb2 G C 11: 98,427,351 R471P possibly damaging Het
Esf1 T A 2: 140,120,871 Y760F possibly damaging Het
Fanci C A 7: 79,439,630 T938K probably benign Het
Gnai3 A G 3: 108,115,757 probably benign Het
Hspg2 T A 4: 137,511,158 C319S probably damaging Het
Il12a T A 3: 68,695,187 probably null Het
Inpp4a A G 1: 37,396,160 D837G probably damaging Het
Kcnj5 T A 9: 32,317,863 E13V probably damaging Het
Kcnq3 T A 15: 66,000,038 Y594F probably benign Het
Kif16b T C 2: 142,740,937 E556G probably damaging Het
Kif28 T C 1: 179,740,089 I39V possibly damaging Het
Lgi2 T C 5: 52,554,549 E143G probably damaging Het
Med12l T C 3: 59,093,504 probably benign Het
Mmp19 G T 10: 128,798,883 R456L probably benign Het
Mon1b T A 8: 113,639,078 V346E probably damaging Het
Mpv17l A T 16: 13,940,999 I96L probably benign Het
Mrgpra9 A T 7: 47,252,794 M1K probably null Het
Mycbp2 A T 14: 103,156,667 H2819Q probably benign Het
Nav1 A C 1: 135,448,917 probably benign Het
Neurl4 T C 11: 69,911,733 probably benign Het
Ntng2 G C 2: 29,207,426 P341R probably damaging Het
Oas1d A T 5: 120,917,028 Y221F probably damaging Het
Olfr1040 A G 2: 86,146,630 Y35H probably damaging Het
Olfr348 C A 2: 36,786,862 D112E probably benign Het
Olfr365 A C 2: 37,202,184 probably null Het
Osbpl8 A G 10: 111,272,282 M380V probably benign Het
Pank1 T C 19: 34,821,706 probably benign Het
Parn T C 16: 13,654,476 D169G possibly damaging Het
Pknox1 T A 17: 31,603,192 I311N probably damaging Het
Pprc1 T C 19: 46,062,775 V248A possibly damaging Het
Prkcq T C 2: 11,254,234 C322R probably benign Het
Ptpn13 T A 5: 103,555,062 I1298N probably benign Het
Rab11fip3 A G 17: 26,069,072 S36P probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Sass6 C A 3: 116,607,308 probably benign Het
Shroom3 G A 5: 92,951,293 G1463D probably benign Het
Slc35d1 A T 4: 103,184,887 Y249* probably null Het
Slc9a3 C T 13: 74,121,536 P8S unknown Het
Slc9a9 T A 9: 94,939,563 probably null Het
Syne2 T A 12: 75,986,975 M3666K probably benign Het
Synpo2 A G 3: 123,079,897 V1140A probably benign Het
Thada A G 17: 84,231,096 F1495L probably benign Het
Timeless A G 10: 128,241,425 probably null Het
Tlr6 G T 5: 64,955,205 H120N possibly damaging Het
Tmem173 A G 18: 35,735,111 probably null Het
Tns3 T C 11: 8,445,703 I1234V probably benign Het
Ttll9 A G 2: 153,000,179 S318G probably benign Het
Vps13c T C 9: 67,922,915 probably benign Het
Zfp933 T C 4: 147,826,442 I232M probably benign Het
Zfyve27 T C 19: 42,189,585 S382P probably damaging Het
Other mutations in Mast1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01395:Mast1 APN 8 84912815 missense possibly damaging 0.87
IGL01862:Mast1 APN 8 84913246 intron probably null
IGL01918:Mast1 APN 8 84921209 missense probably damaging 1.00
IGL02212:Mast1 APN 8 84921397 missense probably damaging 1.00
IGL02221:Mast1 APN 8 84918755 missense possibly damaging 0.92
IGL02370:Mast1 APN 8 84912254 missense probably benign
IGL02470:Mast1 APN 8 84921212 missense probably damaging 1.00
IGL02596:Mast1 APN 8 84917771 missense probably benign
IGL02716:Mast1 APN 8 84935723 missense probably damaging 1.00
IGL02987:Mast1 APN 8 84925719 missense possibly damaging 0.75
IGL03287:Mast1 APN 8 84913353 missense probably benign 0.01
R0255:Mast1 UTSW 8 84912021 missense probably benign
R0480:Mast1 UTSW 8 84913089 missense probably damaging 0.99
R0727:Mast1 UTSW 8 84921415 missense probably damaging 1.00
R1175:Mast1 UTSW 8 84925327 missense probably benign 0.29
R1297:Mast1 UTSW 8 84912716 missense probably benign 0.05
R1328:Mast1 UTSW 8 84917988 intron probably benign
R1454:Mast1 UTSW 8 84920635 missense probably damaging 1.00
R1532:Mast1 UTSW 8 84928609 nonsense probably null
R1752:Mast1 UTSW 8 84925336 missense probably benign
R1777:Mast1 UTSW 8 84912068 missense probably benign
R1905:Mast1 UTSW 8 84916266 missense probably damaging 1.00
R1906:Mast1 UTSW 8 84916266 missense probably damaging 1.00
R1907:Mast1 UTSW 8 84916266 missense probably damaging 1.00
R2056:Mast1 UTSW 8 84920366 missense possibly damaging 0.95
R2071:Mast1 UTSW 8 84921194 missense probably damaging 1.00
R2145:Mast1 UTSW 8 84921478 missense probably damaging 1.00
R2318:Mast1 UTSW 8 84921125 missense probably damaging 1.00
R2842:Mast1 UTSW 8 84923908 missense probably damaging 1.00
R3870:Mast1 UTSW 8 84918731 missense probably damaging 1.00
R3895:Mast1 UTSW 8 84935723 missense probably damaging 1.00
R3973:Mast1 UTSW 8 84918764 missense probably damaging 1.00
R4405:Mast1 UTSW 8 84920891 missense probably damaging 1.00
R4533:Mast1 UTSW 8 84921361 missense probably damaging 1.00
R4725:Mast1 UTSW 8 84929006 missense possibly damaging 0.93
R4770:Mast1 UTSW 8 84929246 missense probably benign 0.02
R4776:Mast1 UTSW 8 84937193 critical splice donor site probably null
R4835:Mast1 UTSW 8 84923779 missense probably damaging 1.00
R4871:Mast1 UTSW 8 84920658 missense probably damaging 1.00
R4953:Mast1 UTSW 8 84918728 missense probably damaging 0.99
R4960:Mast1 UTSW 8 84917871 missense probably benign
R4978:Mast1 UTSW 8 84935787 missense probably damaging 0.98
R5164:Mast1 UTSW 8 84913518 unclassified probably benign
R5235:Mast1 UTSW 8 84913439 missense probably damaging 1.00
R5297:Mast1 UTSW 8 84913318 critical splice donor site probably null
R5463:Mast1 UTSW 8 84925507 missense probably damaging 1.00
R5546:Mast1 UTSW 8 84916260 missense probably damaging 1.00
R5651:Mast1 UTSW 8 84928968 nonsense probably null
R6124:Mast1 UTSW 8 84925307 missense probably benign 0.01
R6213:Mast1 UTSW 8 84915569 missense probably damaging 1.00
R6717:Mast1 UTSW 8 84917754 missense probably benign
X0066:Mast1 UTSW 8 84920878 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGACTGTTGGAATTGAAGGCACAC -3'
(R):5'- TGAGGTGGTAGAGCTGATCCTGAAG -3'

Sequencing Primer
(F):5'- CTCCTGTTGAAACAAGTCTAACCTG -3'
(R):5'- GCTGATCCTGAAGGTGAATGTAG -3'
Posted On2013-04-24