Incidental Mutation 'R4051:Fli1'
ID314165
Institutional Source Beutler Lab
Gene Symbol Fli1
Ensembl Gene ENSMUSG00000016087
Gene NameFriend leukemia integration 1
SynonymsSIC-1, EWSR2, Sic1, Fli-1
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.740) question?
Stock #R4051 ()
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location32422204-32542861 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 32452162 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 176 (D176A)
Ref Sequence ENSEMBL: ENSMUSP00000138984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016231] [ENSMUST00000183767]
Predicted Effect probably benign
Transcript: ENSMUST00000016231
AA Change: D209A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000016231
Gene: ENSMUSG00000016087
AA Change: D209A

DomainStartEndE-ValueType
SAM_PNT 114 198 2.52e-38 SMART
ETS 280 365 1.22e-57 SMART
low complexity region 402 414 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183767
AA Change: D176A

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000138984
Gene: ENSMUSG00000016087
AA Change: D176A

DomainStartEndE-ValueType
SAM_PNT 81 165 2.52e-38 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor containing an ETS DNA-binding domain. The gene can undergo a t(11;22)(q24;q12) translocation with the Ewing sarcoma gene on chromosome 22, which results in a fusion gene that is present in the majority of Ewing sarcoma cases. An acute lymphoblastic leukemia-associated t(4;11)(q21;q23) translocation involving this gene has also been identified. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for most knock-out allele exhibit abnormal hematopoietic and immune systems. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 A C 7: 45,986,563 L1020R probably damaging Het
Ahnak A C 19: 9,014,327 D4325A probably damaging Het
Chtf18 A G 17: 25,719,194 V955A probably damaging Het
Dclk2 A G 3: 86,830,822 probably null Het
Disc1 A G 8: 125,148,425 T547A possibly damaging Het
Eif4b A G 15: 102,086,604 Y211C probably benign Het
Hcn2 A C 10: 79,733,687 probably null Het
Ice1 A G 13: 70,603,527 V1480A probably damaging Het
Ier5l A C 2: 30,473,312 S234A probably benign Het
Ino80b G C 6: 83,122,333 P178R probably damaging Het
Itga11 C T 9: 62,755,651 Q550* probably null Het
Kdr T A 5: 75,968,408 M193L probably benign Het
Kif3b G A 2: 153,323,557 R628Q probably damaging Het
Ldlrad3 C T 2: 101,953,162 D240N probably damaging Het
Met T C 6: 17,548,729 V924A possibly damaging Het
Olfr554 T C 7: 102,641,026 V260A possibly damaging Het
Peg10 T C 6: 4,754,534 L105P probably benign Het
Phtf1 A G 3: 104,005,508 T717A possibly damaging Het
Ptafr T C 4: 132,579,994 W232R probably benign Het
Rnase4 A G 14: 51,105,005 K62R probably benign Het
Slamf7 T C 1: 171,637,383 K261E possibly damaging Het
Slc9c1 T A 16: 45,543,230 Y120N probably damaging Het
Sstr2 A C 11: 113,624,656 T134P probably damaging Het
Steap4 A G 5: 7,980,404 Y420C probably damaging Het
Tbc1d9b T C 11: 50,171,243 C1210R probably benign Het
Tnfsf10 T A 3: 27,335,354 I188N probably damaging Het
Trav7-3 A G 14: 53,443,746 T82A probably benign Het
Usp46 T C 5: 74,002,755 N283S probably benign Het
Vmn2r84 T G 10: 130,390,898 N357T probably damaging Het
Zfp217 T C 2: 170,112,616 probably null Het
Other mutations in Fli1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Fli1 APN 9 32423940 missense probably benign 0.31
IGL01329:Fli1 APN 9 32424101 missense probably damaging 1.00
IGL01925:Fli1 APN 9 32465831 missense probably damaging 1.00
IGL01951:Fli1 APN 9 32461364 missense probably damaging 0.99
IGL01963:Fli1 APN 9 32424207 nonsense probably null
IGL02889:Fli1 APN 9 32465696 missense probably damaging 1.00
R0026:Fli1 UTSW 9 32476584 missense probably damaging 1.00
R0243:Fli1 UTSW 9 32423981 missense probably benign 0.00
R0279:Fli1 UTSW 9 32461427 missense probably damaging 1.00
R0418:Fli1 UTSW 9 32452129 splice site probably benign
R0967:Fli1 UTSW 9 32461449 missense probably benign
R1228:Fli1 UTSW 9 32423843 missense probably damaging 1.00
R1557:Fli1 UTSW 9 32461244 splice site probably benign
R1875:Fli1 UTSW 9 32423913 missense probably benign 0.03
R3401:Fli1 UTSW 9 32461274 missense probably damaging 1.00
R3898:Fli1 UTSW 9 32476722 missense possibly damaging 0.88
R6440:Fli1 UTSW 9 32423901 missense probably benign 0.07
R6901:Fli1 UTSW 9 32429925 missense probably benign 0.14
R7061:Fli1 UTSW 9 32424222 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTCTGAAATGGTGGCAGAGG -3'
(R):5'- AGATCTGCTGTTCTAGACACTGAG -3'

Sequencing Primer
(F):5'- CAGAGGAAGAAAAACATGGTCTTTAG -3'
(R):5'- CTGTTATAGTATCGACATCCCAGAGG -3'
Posted On2015-04-30