Incidental Mutation 'R4052:Thrap3'
ID314193
Institutional Source Beutler Lab
Gene Symbol Thrap3
Ensembl Gene ENSMUSG00000043962
Gene Namethyroid hormone receptor associated protein 3
Synonyms9330151F09Rik, B230333E16Rik, Trap150
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.320) question?
Stock #R4052 ()
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location126164082-126202760 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 126176219 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 625 (A625V)
Ref Sequence ENSEMBL: ENSMUSP00000101748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080919] [ENSMUST00000106142] [ENSMUST00000123008] [ENSMUST00000136157] [ENSMUST00000163176] [ENSMUST00000163306] [ENSMUST00000169403]
Predicted Effect probably damaging
Transcript: ENSMUST00000080919
AA Change: A625V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000079722
Gene: ENSMUSG00000043962
AA Change: A625V

DomainStartEndE-ValueType
low complexity region 2 55 N/A INTRINSIC
low complexity region 77 95 N/A INTRINSIC
low complexity region 99 108 N/A INTRINSIC
Pfam:THRAP3_BCLAF1 123 788 1.9e-207 PFAM
low complexity region 790 801 N/A INTRINSIC
low complexity region 835 854 N/A INTRINSIC
low complexity region 892 910 N/A INTRINSIC
low complexity region 924 938 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106142
AA Change: A625V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101748
Gene: ENSMUSG00000043962
AA Change: A625V

DomainStartEndE-ValueType
low complexity region 2 55 N/A INTRINSIC
low complexity region 77 95 N/A INTRINSIC
low complexity region 99 108 N/A INTRINSIC
Pfam:THRAP3_BCLAF1 123 709 8.7e-163 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123008
SMART Domains Protein: ENSMUSP00000131956
Gene: ENSMUSG00000043962

DomainStartEndE-ValueType
low complexity region 2 47 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136157
SMART Domains Protein: ENSMUSP00000120140
Gene: ENSMUSG00000043962

DomainStartEndE-ValueType
low complexity region 6 53 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151728
Predicted Effect probably benign
Transcript: ENSMUST00000163176
Predicted Effect probably damaging
Transcript: ENSMUST00000163306
AA Change: A97V

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000126399
Gene: ENSMUSG00000043962
AA Change: A97V

DomainStartEndE-ValueType
Pfam:THRAP3_BCLAF1 49 136 1.2e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163459
SMART Domains Protein: ENSMUSP00000129775
Gene: ENSMUSG00000043962

DomainStartEndE-ValueType
Pfam:THRAP3_BCLAF1 1 39 4e-17 PFAM
low complexity region 41 58 N/A INTRINSIC
low complexity region 59 77 N/A INTRINSIC
low complexity region 81 92 N/A INTRINSIC
Pfam:Btz 124 192 3.1e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169403
SMART Domains Protein: ENSMUSP00000125856
Gene: ENSMUSG00000043962

DomainStartEndE-ValueType
low complexity region 2 51 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169855
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110070M22Rik T G 13: 119,488,202 probably benign Het
Abca8b G A 11: 109,981,725 Q17* probably null Het
Abcc6 A C 7: 45,986,563 L1020R probably damaging Het
Ace2 A G X: 164,169,585 I110V probably benign Het
Adam29 T C 8: 55,872,282 Y379C probably damaging Het
Apol10a A T 15: 77,488,985 I274L probably benign Het
BC005537 T A 13: 24,809,898 F119I possibly damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cts3 T A 13: 61,568,721 I34L probably benign Het
Cyp4a30b A G 4: 115,454,342 D69G probably benign Het
Dclk2 A G 3: 86,830,822 probably null Het
Dhx30 A G 9: 110,100,821 V69A possibly damaging Het
Dis3 T G 14: 99,095,316 I227L probably benign Het
Dock3 A G 9: 106,973,796 S836P probably damaging Het
Efhc2 T C X: 17,230,550 N186S possibly damaging Het
Erap1 A G 13: 74,675,340 N831S probably benign Het
Gimap3 T A 6: 48,766,513 T3S possibly damaging Het
Gpr82 C T X: 13,665,659 P149S probably damaging Het
H3f3a C T 1: 180,803,138 R117H probably benign Het
Hcn2 A C 10: 79,733,687 probably null Het
Helz2 A G 2: 181,240,475 L175P probably damaging Het
Il1f8 T C 2: 24,159,832 F152L probably damaging Het
Ino80b G C 6: 83,122,333 P178R probably damaging Het
Ldlrad3 C T 2: 101,953,162 D240N probably damaging Het
Lef1 A G 3: 131,194,689 N236D probably damaging Het
Macf1 A G 4: 123,472,017 S1419P probably benign Het
Me2 T C 18: 73,791,085 K352R probably benign Het
Ncapd3 T A 9: 27,089,383 probably null Het
Olfr665 A G 7: 104,881,603 T299A probably damaging Het
P2rx7 T C 5: 122,666,277 F293S probably damaging Het
Pabpc1l T C 2: 164,043,613 W429R probably benign Het
Parp14 T C 16: 35,858,401 E399G probably benign Het
Pde6h A G 6: 136,959,268 D3G unknown Het
Pfkfb1 A T X: 150,622,188 D208V possibly damaging Het
Rasgrp3 T C 17: 75,496,968 F89L probably damaging Het
Rif1 A T 2: 52,098,471 K741* probably null Het
Rnase4 A G 14: 51,105,005 K62R probably benign Het
Rnf207 C A 4: 152,311,437 Q533H probably benign Het
Slc24a2 A G 4: 87,227,205 V204A probably damaging Het
Spry2 A T 14: 105,893,201 C184S probably damaging Het
Sulf2 T C 2: 166,094,590 Y152C probably damaging Het
Tmem39a T A 16: 38,586,288 V329D probably damaging Het
Trav7-3 A G 14: 53,443,746 T82A probably benign Het
Trim30b T A 7: 104,357,478 Q57L possibly damaging Het
Uggt1 A G 1: 36,164,489 V1020A probably damaging Het
Zfp941 T G 7: 140,812,427 K340Q possibly damaging Het
Other mutations in Thrap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Thrap3 APN 4 126165578 missense probably benign 0.01
IGL00654:Thrap3 APN 4 126165578 missense probably benign 0.01
IGL00763:Thrap3 APN 4 126165578 missense probably benign 0.01
IGL00907:Thrap3 APN 4 126165578 missense probably benign 0.01
IGL00990:Thrap3 APN 4 126165395 unclassified probably benign
IGL01722:Thrap3 APN 4 126165529 missense possibly damaging 0.87
IGL02487:Thrap3 APN 4 126167001 missense possibly damaging 0.93
IGL02802:Thrap3 UTSW 4 126165364 unclassified probably benign
IGL02837:Thrap3 UTSW 4 126165364 unclassified probably benign
IGL02988:Thrap3 UTSW 4 126165542 splice site probably null
IGL03050:Thrap3 UTSW 4 126165542 splice site probably null
IGL03055:Thrap3 UTSW 4 126165542 splice site probably null
R0585:Thrap3 UTSW 4 126178574 unclassified probably null
R1023:Thrap3 UTSW 4 126180089 missense possibly damaging 0.73
R1237:Thrap3 UTSW 4 126180069 missense probably benign 0.02
R1445:Thrap3 UTSW 4 126176336 missense probably damaging 1.00
R1601:Thrap3 UTSW 4 126180101 missense probably damaging 1.00
R2058:Thrap3 UTSW 4 126180174 missense probably damaging 1.00
R2063:Thrap3 UTSW 4 126175396 missense possibly damaging 0.57
R2064:Thrap3 UTSW 4 126175396 missense possibly damaging 0.57
R2065:Thrap3 UTSW 4 126175396 missense possibly damaging 0.57
R2066:Thrap3 UTSW 4 126175396 missense possibly damaging 0.57
R2067:Thrap3 UTSW 4 126175396 missense possibly damaging 0.57
R2098:Thrap3 UTSW 4 126180030 missense probably damaging 1.00
R3791:Thrap3 UTSW 4 126167500 missense possibly damaging 0.76
R4097:Thrap3 UTSW 4 126171802 missense probably damaging 1.00
R4153:Thrap3 UTSW 4 126173442 critical splice donor site probably null
R4399:Thrap3 UTSW 4 126167079 splice site probably benign
R5265:Thrap3 UTSW 4 126167640 missense probably damaging 1.00
R5687:Thrap3 UTSW 4 126180486 unclassified probably benign
R5993:Thrap3 UTSW 4 126175460 unclassified probably null
R6305:Thrap3 UTSW 4 126180807 unclassified probably benign
R6917:Thrap3 UTSW 4 126180492 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GCTAGCATTTCAAAACACTCATCTC -3'
(R):5'- AGATGGCTAACCCTGGTGATC -3'

Sequencing Primer
(F):5'- CCTGTAGCTTTAACGGTC -3'
(R):5'- CTGTAAAGGCTGACCCATTCATG -3'
Posted On2015-04-30