Incidental Mutation 'R4052:3110070M22Rik'
List |< first << previous [record 46 of 9592] next >> last >|
ID314218
Institutional Source Beutler Lab
Gene Symbol 3110070M22Rik
Ensembl Gene ENSMUSG00000074635
Gene NameRIKEN cDNA 3110070M22 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R4052 ()
Quality Score176
Status Not validated
Chromosome13
Chromosomal Location119487261-119488383 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to G at 119488202 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026519] [ENSMUST00000099147] [ENSMUST00000099148] [ENSMUST00000176171] [ENSMUST00000223912] [ENSMUST00000224312] [ENSMUST00000225186] [ENSMUST00000225726]
Predicted Effect probably benign
Transcript: ENSMUST00000026519
SMART Domains Protein: ENSMUSP00000026519
Gene: ENSMUSG00000062822

DomainStartEndE-ValueType
Pfam:DUF4524 9 154 5e-61 PFAM
Pfam:DUF4520 451 542 8.6e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099147
SMART Domains Protein: ENSMUSP00000096751
Gene: ENSMUSG00000074634

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
transmembrane domain 136 158 N/A INTRINSIC
transmembrane domain 202 224 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000099148
AA Change: T3P
SMART Domains Protein: ENSMUSP00000096752
Gene: ENSMUSG00000074635
AA Change: T3P

DomainStartEndE-ValueType
low complexity region 66 80 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176171
SMART Domains Protein: ENSMUSP00000135685
Gene: ENSMUSG00000074634

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
transmembrane domain 136 158 N/A INTRINSIC
transmembrane domain 202 224 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177361
SMART Domains Protein: ENSMUSP00000134785
Gene: ENSMUSG00000074634

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223912
Predicted Effect probably benign
Transcript: ENSMUST00000224312
Predicted Effect probably benign
Transcript: ENSMUST00000225186
Predicted Effect probably benign
Transcript: ENSMUST00000225726
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b G A 11: 109,981,725 Q17* probably null Het
Abcc6 A C 7: 45,986,563 L1020R probably damaging Het
Ace2 A G X: 164,169,585 I110V probably benign Het
Adam29 T C 8: 55,872,282 Y379C probably damaging Het
Apol10a A T 15: 77,488,985 I274L probably benign Het
BC005537 T A 13: 24,809,898 F119I possibly damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cts3 T A 13: 61,568,721 I34L probably benign Het
Cyp4a30b A G 4: 115,454,342 D69G probably benign Het
Dclk2 A G 3: 86,830,822 probably null Het
Dhx30 A G 9: 110,100,821 V69A possibly damaging Het
Dis3 T G 14: 99,095,316 I227L probably benign Het
Dock3 A G 9: 106,973,796 S836P probably damaging Het
Efhc2 T C X: 17,230,550 N186S possibly damaging Het
Erap1 A G 13: 74,675,340 N831S probably benign Het
Gimap3 T A 6: 48,766,513 T3S possibly damaging Het
Gpr82 C T X: 13,665,659 P149S probably damaging Het
H3f3a C T 1: 180,803,138 R117H probably benign Het
Hcn2 A C 10: 79,733,687 probably null Het
Helz2 A G 2: 181,240,475 L175P probably damaging Het
Il1f8 T C 2: 24,159,832 F152L probably damaging Het
Ino80b G C 6: 83,122,333 P178R probably damaging Het
Ldlrad3 C T 2: 101,953,162 D240N probably damaging Het
Lef1 A G 3: 131,194,689 N236D probably damaging Het
Macf1 A G 4: 123,472,017 S1419P probably benign Het
Me2 T C 18: 73,791,085 K352R probably benign Het
Ncapd3 T A 9: 27,089,383 probably null Het
Olfr665 A G 7: 104,881,603 T299A probably damaging Het
P2rx7 T C 5: 122,666,277 F293S probably damaging Het
Pabpc1l T C 2: 164,043,613 W429R probably benign Het
Parp14 T C 16: 35,858,401 E399G probably benign Het
Pde6h A G 6: 136,959,268 D3G unknown Het
Pfkfb1 A T X: 150,622,188 D208V possibly damaging Het
Rasgrp3 T C 17: 75,496,968 F89L probably damaging Het
Rif1 A T 2: 52,098,471 K741* probably null Het
Rnase4 A G 14: 51,105,005 K62R probably benign Het
Rnf207 C A 4: 152,311,437 Q533H probably benign Het
Slc24a2 A G 4: 87,227,205 V204A probably damaging Het
Spry2 A T 14: 105,893,201 C184S probably damaging Het
Sulf2 T C 2: 166,094,590 Y152C probably damaging Het
Thrap3 G A 4: 126,176,219 A625V probably damaging Het
Tmem39a T A 16: 38,586,288 V329D probably damaging Het
Trav7-3 A G 14: 53,443,746 T82A probably benign Het
Trim30b T A 7: 104,357,478 Q57L possibly damaging Het
Uggt1 A G 1: 36,164,489 V1020A probably damaging Het
Zfp941 T G 7: 140,812,427 K340Q possibly damaging Het
Other mutations in 3110070M22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4630:3110070M22Rik UTSW 13 119488086 unclassified probably benign
R6413:3110070M22Rik UTSW 13 119488111 unclassified probably benign
R6452:3110070M22Rik UTSW 13 119488115 unclassified probably benign
R6902:3110070M22Rik UTSW 13 119488144 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCTTGAGAAATCCCCAAGGG -3'
(R):5'- CTCTGAGAGGTTTCGAGTCC -3'

Sequencing Primer
(F):5'- CCAAGGGGGCGGTGAAG -3'
(R):5'- AGAGGTTTCGAGTCCACCCTG -3'
Posted On2015-04-30