Incidental Mutation 'R4052:Spry2'
ID 314221
Institutional Source Beutler Lab
Gene Symbol Spry2
Ensembl Gene ENSMUSG00000022114
Gene Name sprouty RTK signaling antagonist 2
Synonyms sprouty2
Accession Numbers
Essential gene? Probably essential (E-score: 0.900) question?
Stock # R4052 ()
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 106129381-106134253 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 106130635 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 184 (C184S)
Ref Sequence ENSEMBL: ENSMUSP00000022709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022709]
AlphaFold Q9QXV8
Predicted Effect probably damaging
Transcript: ENSMUST00000022709
AA Change: C184S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000022709
Gene: ENSMUSG00000022114
AA Change: C184S

DomainStartEndE-ValueType
low complexity region 107 130 N/A INTRINSIC
Pfam:Sprouty 183 301 2.8e-38 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the sprouty family. The encoded protein contains a carboxyl-terminal cysteine-rich domain essential for the inhibitory activity on receptor tyrosine kinase signaling proteins and is required for growth factor stimulated translocation of the protein to membrane ruffles. In primary dermal endothelial cells this gene is transiently upregulated in response to fibroblast growth factor two. This protein is indirectly involved in the non-cell autonomous inhibitory effect on fibroblast growth factor two signaling. The protein interacts with Cas-Br-M (murine) ectropic retroviral transforming sequence, and can function as a bimodal regulator of epidermal growth factor receptor/mitogen-activated protein kinase signaling. This protein may play a role in alveoli branching during lung development as shown by a similar mouse protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit enteric nerve hyperplasia which led to esophangeal achalasia and intestinal pseudo-obstruction. Mice also have intermediate to severe hearing loss with abnormalities in the organ of Corti and about half die prematurely. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110070M22Rik T G 13: 119,624,738 (GRCm39) probably benign Het
Abca8b G A 11: 109,872,551 (GRCm39) Q17* probably null Het
Abcc6 A C 7: 45,635,987 (GRCm39) L1020R probably damaging Het
Ace2 A G X: 162,952,581 (GRCm39) I110V probably benign Het
Adam29 T C 8: 56,325,317 (GRCm39) Y379C probably damaging Het
Apol10a A T 15: 77,373,185 (GRCm39) I274L probably benign Het
BC005537 T A 13: 24,993,881 (GRCm39) F119I possibly damaging Het
Crygs C T 16: 22,624,301 (GRCm39) G102D possibly damaging Het
Cts3 T A 13: 61,716,535 (GRCm39) I34L probably benign Het
Cyp4a30b A G 4: 115,311,539 (GRCm39) D69G probably benign Het
Dclk2 A G 3: 86,738,129 (GRCm39) probably null Het
Dhx30 A G 9: 109,929,889 (GRCm39) V69A possibly damaging Het
Dis3 T G 14: 99,332,752 (GRCm39) I227L probably benign Het
Dock3 A G 9: 106,850,995 (GRCm39) S836P probably damaging Het
Efhc2 T C X: 17,096,789 (GRCm39) N186S possibly damaging Het
Erap1 A G 13: 74,823,459 (GRCm39) N831S probably benign Het
Gimap3 T A 6: 48,743,447 (GRCm39) T3S possibly damaging Het
Gpr82 C T X: 13,531,898 (GRCm39) P149S probably damaging Het
H3f3a C T 1: 180,630,703 (GRCm39) R117H probably benign Het
Hcn2 A C 10: 79,569,521 (GRCm39) probably null Het
Helz2 A G 2: 180,882,268 (GRCm39) L175P probably damaging Het
Il36b T C 2: 24,049,844 (GRCm39) F152L probably damaging Het
Ino80b G C 6: 83,099,314 (GRCm39) P178R probably damaging Het
Ldlrad3 C T 2: 101,783,507 (GRCm39) D240N probably damaging Het
Lef1 A G 3: 130,988,338 (GRCm39) N236D probably damaging Het
Macf1 A G 4: 123,365,810 (GRCm39) S1419P probably benign Het
Me2 T C 18: 73,924,156 (GRCm39) K352R probably benign Het
Ncapd3 T A 9: 27,000,679 (GRCm39) probably null Het
Or52n3 A G 7: 104,530,810 (GRCm39) T299A probably damaging Het
P2rx7 T C 5: 122,804,340 (GRCm39) F293S probably damaging Het
Pabpc1l T C 2: 163,885,533 (GRCm39) W429R probably benign Het
Parp14 T C 16: 35,678,771 (GRCm39) E399G probably benign Het
Pde6h A G 6: 136,936,266 (GRCm39) D3G unknown Het
Pfkfb1 A T X: 149,405,184 (GRCm39) D208V possibly damaging Het
Rasgrp3 T C 17: 75,803,963 (GRCm39) F89L probably damaging Het
Rif1 A T 2: 51,988,483 (GRCm39) K741* probably null Het
Rnase4 A G 14: 51,342,462 (GRCm39) K62R probably benign Het
Rnf207 C A 4: 152,395,894 (GRCm39) Q533H probably benign Het
Slc24a2 A G 4: 87,145,442 (GRCm39) V204A probably damaging Het
Sulf2 T C 2: 165,936,510 (GRCm39) Y152C probably damaging Het
Thrap3 G A 4: 126,070,012 (GRCm39) A625V probably damaging Het
Tmem39a T A 16: 38,406,650 (GRCm39) V329D probably damaging Het
Trav7-3 A G 14: 53,681,203 (GRCm39) T82A probably benign Het
Trim30b T A 7: 104,006,685 (GRCm39) Q57L possibly damaging Het
Uggt1 A G 1: 36,203,570 (GRCm39) V1020A probably damaging Het
Zfp941 T G 7: 140,392,340 (GRCm39) K340Q possibly damaging Het
Other mutations in Spry2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01747:Spry2 APN 14 106,130,488 (GRCm39) missense probably damaging 1.00
Eagle UTSW 14 106,130,791 (GRCm39) nonsense probably null
Osprey UTSW 14 106,130,418 (GRCm39) missense possibly damaging 0.92
G1citation:Spry2 UTSW 14 106,130,791 (GRCm39) nonsense probably null
R0016:Spry2 UTSW 14 106,130,731 (GRCm39) missense probably benign 0.08
R0594:Spry2 UTSW 14 106,130,744 (GRCm39) missense possibly damaging 0.50
R0843:Spry2 UTSW 14 106,130,524 (GRCm39) missense probably damaging 1.00
R0943:Spry2 UTSW 14 106,131,021 (GRCm39) missense probably damaging 1.00
R1186:Spry2 UTSW 14 106,130,341 (GRCm39) missense probably damaging 1.00
R5355:Spry2 UTSW 14 106,130,712 (GRCm39) missense probably damaging 0.97
R6306:Spry2 UTSW 14 106,130,418 (GRCm39) missense possibly damaging 0.92
R6822:Spry2 UTSW 14 106,130,791 (GRCm39) nonsense probably null
R7347:Spry2 UTSW 14 106,130,946 (GRCm39) missense probably damaging 1.00
R8424:Spry2 UTSW 14 106,130,836 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TACAACAATGGGACTGGCTGC -3'
(R):5'- TCTCGGAGCAGTACAAGGAC -3'

Sequencing Primer
(F):5'- CAAGAGCACGGGTTGTCAGC -3'
(R):5'- CTCGGAGCAGTACAAGGACAAGTAC -3'
Posted On 2015-04-30