Incidental Mutation 'R4052:Parp14'
ID314224
Institutional Source Beutler Lab
Gene Symbol Parp14
Ensembl Gene ENSMUSG00000034422
Gene Namepoly (ADP-ribose) polymerase family, member 14
Synonymscollaborator of Stat6, 1600029O10Rik, CoaSt6
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.421) question?
Stock #R4052 ()
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location35832874-35871544 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35858401 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 399 (E399G)
Ref Sequence ENSEMBL: ENSMUSP00000037657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042665]
PDB Structure
Solution structure of WWE domain in Parp14 protein [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000042665
AA Change: E399G

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000037657
Gene: ENSMUSG00000034422
AA Change: E399G

DomainStartEndE-ValueType
low complexity region 38 49 N/A INTRINSIC
low complexity region 93 115 N/A INTRINSIC
RRM 228 297 4.71e-2 SMART
coiled coil region 443 468 N/A INTRINSIC
Blast:A1pp 693 746 6e-6 BLAST
low complexity region 771 795 N/A INTRINSIC
A1pp 814 948 7.62e-41 SMART
A1pp 1026 1160 5.88e-24 SMART
A1pp 1239 1358 6.82e-20 SMART
PDB:1X4R|A 1532 1619 9e-53 PDB
Pfam:PARP 1632 1817 2.5e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142946
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the poly(ADP-ribose) polymerase (PARP) protein family. The encoded anti-apoptotic protein may regulate aerobic glycolysis and promote survival of cancer cells. Increased expression of this gene has been reported in a variety of tumor types. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit altered B cell subsets and inability to respond to the apoptosis protective affects of IL4. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110070M22Rik T G 13: 119,488,202 probably benign Het
Abca8b G A 11: 109,981,725 Q17* probably null Het
Abcc6 A C 7: 45,986,563 L1020R probably damaging Het
Ace2 A G X: 164,169,585 I110V probably benign Het
Adam29 T C 8: 55,872,282 Y379C probably damaging Het
Apol10a A T 15: 77,488,985 I274L probably benign Het
BC005537 T A 13: 24,809,898 F119I possibly damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cts3 T A 13: 61,568,721 I34L probably benign Het
Cyp4a30b A G 4: 115,454,342 D69G probably benign Het
Dclk2 A G 3: 86,830,822 probably null Het
Dhx30 A G 9: 110,100,821 V69A possibly damaging Het
Dis3 T G 14: 99,095,316 I227L probably benign Het
Dock3 A G 9: 106,973,796 S836P probably damaging Het
Efhc2 T C X: 17,230,550 N186S possibly damaging Het
Erap1 A G 13: 74,675,340 N831S probably benign Het
Gimap3 T A 6: 48,766,513 T3S possibly damaging Het
Gpr82 C T X: 13,665,659 P149S probably damaging Het
H3f3a C T 1: 180,803,138 R117H probably benign Het
Hcn2 A C 10: 79,733,687 probably null Het
Helz2 A G 2: 181,240,475 L175P probably damaging Het
Il1f8 T C 2: 24,159,832 F152L probably damaging Het
Ino80b G C 6: 83,122,333 P178R probably damaging Het
Ldlrad3 C T 2: 101,953,162 D240N probably damaging Het
Lef1 A G 3: 131,194,689 N236D probably damaging Het
Macf1 A G 4: 123,472,017 S1419P probably benign Het
Me2 T C 18: 73,791,085 K352R probably benign Het
Ncapd3 T A 9: 27,089,383 probably null Het
Olfr665 A G 7: 104,881,603 T299A probably damaging Het
P2rx7 T C 5: 122,666,277 F293S probably damaging Het
Pabpc1l T C 2: 164,043,613 W429R probably benign Het
Pde6h A G 6: 136,959,268 D3G unknown Het
Pfkfb1 A T X: 150,622,188 D208V possibly damaging Het
Rasgrp3 T C 17: 75,496,968 F89L probably damaging Het
Rif1 A T 2: 52,098,471 K741* probably null Het
Rnase4 A G 14: 51,105,005 K62R probably benign Het
Rnf207 C A 4: 152,311,437 Q533H probably benign Het
Slc24a2 A G 4: 87,227,205 V204A probably damaging Het
Spry2 A T 14: 105,893,201 C184S probably damaging Het
Sulf2 T C 2: 166,094,590 Y152C probably damaging Het
Thrap3 G A 4: 126,176,219 A625V probably damaging Het
Tmem39a T A 16: 38,586,288 V329D probably damaging Het
Trav7-3 A G 14: 53,443,746 T82A probably benign Het
Trim30b T A 7: 104,357,478 Q57L possibly damaging Het
Uggt1 A G 1: 36,164,489 V1020A probably damaging Het
Zfp941 T G 7: 140,812,427 K340Q possibly damaging Het
Other mutations in Parp14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Parp14 APN 16 35841075 missense probably benign 0.00
IGL00497:Parp14 APN 16 35834836 missense probably damaging 1.00
IGL00754:Parp14 APN 16 35839371 missense probably benign 0.15
IGL00960:Parp14 APN 16 35841219 missense probably benign 0.20
IGL01321:Parp14 APN 16 35856559 missense probably benign
IGL01397:Parp14 APN 16 35858728 missense probably benign 0.19
IGL01591:Parp14 APN 16 35858507 missense possibly damaging 0.71
IGL01728:Parp14 APN 16 35857435 missense probably damaging 1.00
IGL01734:Parp14 APN 16 35858600 missense probably benign 0.00
IGL02156:Parp14 APN 16 35858597 missense probably benign 0.13
IGL02951:Parp14 APN 16 35858533 missense probably benign 0.06
IGL03067:Parp14 APN 16 35856508 missense probably benign 0.10
IGL03135:Parp14 APN 16 35858011 missense probably damaging 1.00
IGL03141:Parp14 APN 16 35839293 missense probably benign 0.00
IGL03146:Parp14 APN 16 35858453 nonsense probably null
IGL03333:Parp14 APN 16 35841430 missense probably benign 0.08
IGL03391:Parp14 APN 16 35858270 missense probably benign
thurston UTSW 16 35844415 splice site probably benign
R0306:Parp14 UTSW 16 35856574 missense probably benign
R0506:Parp14 UTSW 16 35841409 missense possibly damaging 0.70
R0586:Parp14 UTSW 16 35841012 missense probably benign 0.00
R0606:Parp14 UTSW 16 35856760 missense probably benign 0.09
R0612:Parp14 UTSW 16 35856760 missense probably benign 0.09
R0699:Parp14 UTSW 16 35860585 missense probably damaging 1.00
R0786:Parp14 UTSW 16 35840802 missense possibly damaging 0.86
R0883:Parp14 UTSW 16 35858518 missense probably benign 0.03
R0900:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1087:Parp14 UTSW 16 35858288 missense probably damaging 1.00
R1104:Parp14 UTSW 16 35844415 splice site probably benign
R1120:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1134:Parp14 UTSW 16 35834902 missense probably damaging 1.00
R1153:Parp14 UTSW 16 35857671 missense possibly damaging 0.49
R1159:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1160:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1237:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1238:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1239:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1423:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1511:Parp14 UTSW 16 35857224 missense probably benign 0.00
R1518:Parp14 UTSW 16 35856638 missense possibly damaging 0.79
R1619:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1707:Parp14 UTSW 16 35857849 missense probably damaging 1.00
R1792:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1831:Parp14 UTSW 16 35858588 missense possibly damaging 0.77
R1840:Parp14 UTSW 16 35863449 missense probably damaging 1.00
R1889:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1902:Parp14 UTSW 16 35853518 critical splice donor site probably null
R1943:Parp14 UTSW 16 35836129 missense probably damaging 1.00
R1954:Parp14 UTSW 16 35858301 missense probably benign 0.08
R2115:Parp14 UTSW 16 35858534 missense probably benign 0.16
R2216:Parp14 UTSW 16 35857205 missense probably benign 0.00
R2519:Parp14 UTSW 16 35858203 missense possibly damaging 0.95
R3851:Parp14 UTSW 16 35853748 missense possibly damaging 0.92
R4671:Parp14 UTSW 16 35858321 missense probably benign 0.00
R4867:Parp14 UTSW 16 35857327 missense probably benign 0.01
R4941:Parp14 UTSW 16 35846033 missense probably benign
R4992:Parp14 UTSW 16 35841142 missense probably benign 0.05
R5055:Parp14 UTSW 16 35844363 missense probably benign 0.00
R5073:Parp14 UTSW 16 35834707 missense probably damaging 0.99
R5170:Parp14 UTSW 16 35857279 missense probably benign 0.21
R5422:Parp14 UTSW 16 35866175 missense probably benign 0.01
R5543:Parp14 UTSW 16 35834767 missense probably benign 0.00
R5549:Parp14 UTSW 16 35841135 missense probably benign 0.00
R5553:Parp14 UTSW 16 35856936 missense probably benign 0.01
R5691:Parp14 UTSW 16 35863539 missense probably benign 0.12
R5774:Parp14 UTSW 16 35858410 missense probably damaging 1.00
R5855:Parp14 UTSW 16 35840927 nonsense probably null
R5942:Parp14 UTSW 16 35839367 missense probably damaging 0.98
R5990:Parp14 UTSW 16 35841457 missense probably benign 0.14
R5991:Parp14 UTSW 16 35841457 missense probably benign 0.14
R6018:Parp14 UTSW 16 35841457 missense probably benign 0.14
R6022:Parp14 UTSW 16 35841457 missense probably benign 0.14
R6075:Parp14 UTSW 16 35857019 missense probably damaging 0.99
R6395:Parp14 UTSW 16 35856548 missense probably benign 0.00
R6525:Parp14 UTSW 16 35860441 missense probably benign 0.05
R6683:Parp14 UTSW 16 35834677 missense probably damaging 1.00
X0026:Parp14 UTSW 16 35857157 nonsense probably null
X0060:Parp14 UTSW 16 35834707 missense probably damaging 0.99
Z1088:Parp14 UTSW 16 35841586 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTTTTCAGTGGTGCTCTC -3'
(R):5'- AGCATCTTTCCAGGAGTCTCTTG -3'

Sequencing Primer
(F):5'- AGTGGTGCTCTCTATTAATTCCCTG -3'
(R):5'- AGGAGTCTCTTGATCTTCCTTTG -3'
Posted On2015-04-30