Incidental Mutation 'R4056:Rhbg'
ID314234
Institutional Source Beutler Lab
Gene Symbol Rhbg
Ensembl Gene ENSMUSG00000104445
Gene NameRhesus blood group-associated B glycoprotein
Synonyms
MMRRC Submission 041617-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4056 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location88242874-88254709 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 88243448 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 434 (V434I)
Ref Sequence ENSEMBL: ENSMUSP00000130767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171887]
Predicted Effect probably benign
Transcript: ENSMUST00000163277
Predicted Effect unknown
Transcript: ENSMUST00000165196
AA Change: V412I
SMART Domains Protein: ENSMUSP00000132187
Gene: ENSMUSG00000103766
AA Change: V412I

DomainStartEndE-ValueType
Pfam:Ammonium_transp 1 353 9.7e-70 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171887
AA Change: V434I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000130767
Gene: ENSMUSG00000104445
AA Change: V434I

DomainStartEndE-ValueType
low complexity region 3 18 N/A INTRINSIC
Pfam:Ammonium_transp 22 419 5.9e-74 PFAM
Meta Mutation Damage Score 0.0356 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two non-erythroid members of the Rhesus (Rh) protein family. Non-erythroid Rh protein family members are mainly expressed in the kidney and belong to the methylammonium-ammonium permease/ammonia transporters superfamily. All Rh family proteins are predicted to be transmembrane proteins with 12 membrane spanning domains and intracytoplasmic N- and C-termini. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, do not develop hyperammonemic hepatic encephalopathy or distal tubular acidosis, and show a normal renal response to chronic acid-loading and no changes in NH4+ or NH3 entry across the basolateral membrane of cortical collecting ducts cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730455P16Rik T A 11: 80,375,503 probably benign Het
Abcf1 A G 17: 35,959,915 I510T possibly damaging Het
Adamts18 T A 8: 113,737,580 K749* probably null Het
Alms1 A G 6: 85,587,803 E53G unknown Het
Bmper A G 9: 23,399,629 H453R probably benign Het
Btg1 T A 10: 96,618,354 M1K probably null Het
Cntfr A G 4: 41,658,900 I277T probably damaging Het
Col6a4 C A 9: 106,026,466 R1642I probably damaging Het
Ctnna3 T C 10: 65,002,568 I808T probably damaging Het
Cyp1a1 T A 9: 57,700,149 V20D probably benign Het
Dnah17 T C 11: 118,070,538 T2554A probably benign Het
Fcgbp A T 7: 28,104,116 Q1715L probably benign Het
Gabarapl1 T C 6: 129,538,630 F77S probably damaging Het
Gm1966 G T 7: 106,604,009 D9E possibly damaging Het
Hpse2 T C 19: 43,294,275 K180E probably damaging Het
Hs3st2 T A 7: 121,500,702 L257Q probably damaging Het
Ighv1-18 T C 12: 114,682,667 T106A probably benign Het
Ints2 A C 11: 86,242,952 L424R probably damaging Het
Iqgap2 A G 13: 95,750,033 V114A probably damaging Het
Kalrn A T 16: 34,314,209 I401N probably damaging Het
Maats1 A G 16: 38,298,214 V741A probably benign Het
Mast2 T A 4: 116,337,501 probably benign Het
Myo18a A G 11: 77,812,013 E5G possibly damaging Het
Nav3 A T 10: 109,880,533 probably null Het
Net1 G A 13: 3,884,949 T359I probably damaging Het
Pcsk9 T A 4: 106,444,702 H616L probably benign Het
Plekha5 G T 6: 140,589,232 V597L possibly damaging Het
Plekhg3 T A 12: 76,565,247 I374N probably damaging Het
Pros1 A T 16: 62,900,645 R188* probably null Het
Rims1 A G 1: 22,292,939 probably benign Het
Rxfp2 T C 5: 150,051,633 probably null Het
Sbf2 T C 7: 110,441,466 I385V probably damaging Het
Slc22a23 A C 13: 34,299,004 Y181* probably null Het
Spata31 T A 13: 64,921,655 V539E probably benign Het
Trpv5 G A 6: 41,659,705 R436C probably damaging Het
Vmn1r13 G A 6: 57,209,985 C43Y probably benign Het
Wif1 G A 10: 121,082,194 V156I probably benign Het
Zfyve16 T C 13: 92,504,549 N1229S probably damaging Het
Other mutations in Rhbg
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0496:Rhbg UTSW 3 88254498 missense probably benign
R0786:Rhbg UTSW 3 88244568 missense probably benign 0.04
R1397:Rhbg UTSW 3 88248446 missense probably benign 0.14
R1737:Rhbg UTSW 3 88245874 missense probably damaging 1.00
R1927:Rhbg UTSW 3 88244552 missense probably benign 0.00
R2088:Rhbg UTSW 3 88247458 missense probably damaging 1.00
R3976:Rhbg UTSW 3 88244536 missense probably damaging 1.00
R4669:Rhbg UTSW 3 88245966 missense probably damaging 1.00
R4878:Rhbg UTSW 3 88247453 missense probably benign 0.43
R5032:Rhbg UTSW 3 88245134 missense probably damaging 1.00
R5330:Rhbg UTSW 3 88245468 missense probably benign 0.10
R5331:Rhbg UTSW 3 88245468 missense probably benign 0.10
R5788:Rhbg UTSW 3 88245567 missense probably benign 0.00
R6293:Rhbg UTSW 3 88245826 nonsense probably null
R6882:Rhbg UTSW 3 88245220 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACACTGGTCAATGGGGTG -3'
(R):5'- TGCTTCGAGGACCAGGTTTAC -3'

Sequencing Primer
(F):5'- TTCTGGCCACAGCTAATGG -3'
(R):5'- GTTTACTGGGAGGTGAGACAC -3'
Posted On2015-04-30