Incidental Mutation 'R4056:Cntfr'
ID 314235
Institutional Source Beutler Lab
Gene Symbol Cntfr
Ensembl Gene ENSMUSG00000028444
Gene Name ciliary neurotrophic factor receptor
Synonyms Cntfralpha
MMRRC Submission 041617-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4056 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 41657498-41697089 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 41658900 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 277 (I277T)
Ref Sequence ENSEMBL: ENSMUSP00000100027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102961] [ENSMUST00000102962]
AlphaFold O88507
Predicted Effect probably damaging
Transcript: ENSMUST00000102961
AA Change: I277T

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000100026
Gene: ENSMUSG00000028444
AA Change: I277T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IGc2 37 96 1.87e-12 SMART
Blast:FN3 106 190 8e-37 BLAST
FN3 204 290 1.1e-7 SMART
low complexity region 309 332 N/A INTRINSIC
low complexity region 356 371 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102962
AA Change: I277T

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000100027
Gene: ENSMUSG00000028444
AA Change: I277T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IGc2 37 96 1.87e-12 SMART
Blast:FN3 106 190 8e-37 BLAST
FN3 204 290 1.1e-7 SMART
low complexity region 309 332 N/A INTRINSIC
low complexity region 356 371 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151181
Meta Mutation Damage Score 0.1364 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: This gene encodes the alpha subunit of the ciliary neurotrophic factor (CNTF) receptor that triggers the assembly of a trimolecular complex upon binding to CNTF, and initiate a downstream signaling process. The encoded preproprotein undergoes proteolytic processing to generate a glycosylphosphatidylinositol-linked cell surface protein. Mice lacking the encoded protein die shortly after birth and exhibit a reduction of motoneuron number at birth. The transgenic disruption of this gene specifically in the skeletal muscle followed by a peripheral nerve lesion impairs motor neuron axonal regeneration across the lesion site. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous mutant animals exhibit a significant reduction in the number of motor neurons. Neonatal mutants fail to suckle and die within 24 hours after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730455P16Rik T A 11: 80,266,329 (GRCm39) probably benign Het
Abcf1 A G 17: 36,270,807 (GRCm39) I510T possibly damaging Het
Adamts18 T A 8: 114,464,212 (GRCm39) K749* probably null Het
Alms1 A G 6: 85,564,785 (GRCm39) E53G unknown Het
Bmper A G 9: 23,310,925 (GRCm39) H453R probably benign Het
Btg1 T A 10: 96,454,216 (GRCm39) M1K probably null Het
Cfap91 A G 16: 38,118,576 (GRCm39) V741A probably benign Het
Col6a4 C A 9: 105,903,665 (GRCm39) R1642I probably damaging Het
Ctnna3 T C 10: 64,838,347 (GRCm39) I808T probably damaging Het
Cyp1a1 T A 9: 57,607,432 (GRCm39) V20D probably benign Het
Dnah17 T C 11: 117,961,364 (GRCm39) T2554A probably benign Het
Fcgbp A T 7: 27,803,541 (GRCm39) Q1715L probably benign Het
Gabarapl1 T C 6: 129,515,593 (GRCm39) F77S probably damaging Het
Gvin3 G T 7: 106,203,216 (GRCm39) D9E possibly damaging Het
Hpse2 T C 19: 43,282,714 (GRCm39) K180E probably damaging Het
Hs3st2 T A 7: 121,099,925 (GRCm39) L257Q probably damaging Het
Ighv1-18 T C 12: 114,646,287 (GRCm39) T106A probably benign Het
Ints2 A C 11: 86,133,778 (GRCm39) L424R probably damaging Het
Iqgap2 A G 13: 95,886,541 (GRCm39) V114A probably damaging Het
Kalrn A T 16: 34,134,579 (GRCm39) I401N probably damaging Het
Mast2 T A 4: 116,194,698 (GRCm39) probably benign Het
Myo18a A G 11: 77,702,839 (GRCm39) E5G possibly damaging Het
Nav3 A T 10: 109,716,394 (GRCm39) probably null Het
Net1 G A 13: 3,934,949 (GRCm39) T359I probably damaging Het
Pcsk9 T A 4: 106,301,899 (GRCm39) H616L probably benign Het
Plekha5 G T 6: 140,534,958 (GRCm39) V597L possibly damaging Het
Plekhg3 T A 12: 76,612,021 (GRCm39) I374N probably damaging Het
Pros1 A T 16: 62,721,008 (GRCm39) R188* probably null Het
Rhbg C T 3: 88,150,755 (GRCm39) V434I probably damaging Het
Rims1 A G 1: 22,363,163 (GRCm39) probably benign Het
Rxfp2 T C 5: 149,975,098 (GRCm39) probably null Het
Sbf2 T C 7: 110,040,673 (GRCm39) I385V probably damaging Het
Slc22a23 A C 13: 34,482,987 (GRCm39) Y181* probably null Het
Spata31 T A 13: 65,069,469 (GRCm39) V539E probably benign Het
Trpv5 G A 6: 41,636,639 (GRCm39) R436C probably damaging Het
Vmn1r13 G A 6: 57,186,970 (GRCm39) C43Y probably benign Het
Wif1 G A 10: 120,918,099 (GRCm39) V156I probably benign Het
Zfyve16 T C 13: 92,641,057 (GRCm39) N1229S probably damaging Het
Other mutations in Cntfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1215:Cntfr UTSW 4 41,662,064 (GRCm39) missense probably damaging 1.00
R1635:Cntfr UTSW 4 41,658,816 (GRCm39) missense probably damaging 1.00
R1795:Cntfr UTSW 4 41,670,841 (GRCm39) critical splice donor site probably null
R2115:Cntfr UTSW 4 41,663,534 (GRCm39) splice site probably null
R2437:Cntfr UTSW 4 41,671,035 (GRCm39) missense probably damaging 0.99
R4770:Cntfr UTSW 4 41,663,282 (GRCm39) missense possibly damaging 0.57
R5245:Cntfr UTSW 4 41,670,879 (GRCm39) missense possibly damaging 0.92
R5346:Cntfr UTSW 4 41,675,042 (GRCm39) nonsense probably null
R5436:Cntfr UTSW 4 41,663,322 (GRCm39) missense probably damaging 0.98
R5535:Cntfr UTSW 4 41,663,216 (GRCm39) missense probably benign 0.44
R6275:Cntfr UTSW 4 41,663,216 (GRCm39) missense possibly damaging 0.89
R6749:Cntfr UTSW 4 41,663,232 (GRCm39) missense possibly damaging 0.47
R7626:Cntfr UTSW 4 41,662,013 (GRCm39) missense possibly damaging 0.89
R9006:Cntfr UTSW 4 41,661,971 (GRCm39) critical splice donor site probably null
R9524:Cntfr UTSW 4 41,661,995 (GRCm39) missense probably damaging 1.00
R9736:Cntfr UTSW 4 41,658,290 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- ATGTCTGTCACAGCCAGAGAG -3'
(R):5'- TGAAGGACATTCACGGTGGC -3'

Sequencing Primer
(F):5'- AGAGGCTCTGCTCCCAG -3'
(R):5'- ACATTCACGGTGGCCCTCTC -3'
Posted On 2015-04-30