Incidental Mutation 'R4056:Gabarapl1'
ID314242
Institutional Source Beutler Lab
Gene Symbol Gabarapl1
Ensembl Gene ENSMUSG00000030161
Gene Namegamma-aminobutyric acid (GABA) A receptor-associated protein-like 1
Synonyms9130422N19Rik, Atg8l, GECI, 3110025G09Rik, Apg8l
MMRRC Submission 041617-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R4056 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location129533160-129542346 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129538630 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 77 (F77S)
Ref Sequence ENSEMBL: ENSMUSP00000145175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032264] [ENSMUST00000204487] [ENSMUST00000204639] [ENSMUST00000204956]
Predicted Effect probably damaging
Transcript: ENSMUST00000032264
AA Change: F77S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000032264
Gene: ENSMUSG00000030161
AA Change: F77S

DomainStartEndE-ValueType
Pfam:Atg8 13 116 4.6e-52 PFAM
Pfam:APG12 30 116 5.7e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203703
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204323
Predicted Effect probably benign
Transcript: ENSMUST00000204487
SMART Domains Protein: ENSMUSP00000145078
Gene: ENSMUSG00000030161

DomainStartEndE-ValueType
low complexity region 33 51 N/A INTRINSIC
low complexity region 74 89 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204639
Predicted Effect probably damaging
Transcript: ENSMUST00000204956
AA Change: F77S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000145175
Gene: ENSMUSG00000030161
AA Change: F77S

DomainStartEndE-ValueType
Pfam:Atg8 13 116 4.6e-52 PFAM
Pfam:APG12 30 116 5.7e-11 PFAM
Meta Mutation Damage Score 0.314 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730455P16Rik T A 11: 80,375,503 probably benign Het
Abcf1 A G 17: 35,959,915 I510T possibly damaging Het
Adamts18 T A 8: 113,737,580 K749* probably null Het
Alms1 A G 6: 85,587,803 E53G unknown Het
Bmper A G 9: 23,399,629 H453R probably benign Het
Btg1 T A 10: 96,618,354 M1K probably null Het
Cntfr A G 4: 41,658,900 I277T probably damaging Het
Col6a4 C A 9: 106,026,466 R1642I probably damaging Het
Ctnna3 T C 10: 65,002,568 I808T probably damaging Het
Cyp1a1 T A 9: 57,700,149 V20D probably benign Het
Dnah17 T C 11: 118,070,538 T2554A probably benign Het
Fcgbp A T 7: 28,104,116 Q1715L probably benign Het
Gm1966 G T 7: 106,604,009 D9E possibly damaging Het
Hpse2 T C 19: 43,294,275 K180E probably damaging Het
Hs3st2 T A 7: 121,500,702 L257Q probably damaging Het
Ighv1-18 T C 12: 114,682,667 T106A probably benign Het
Ints2 A C 11: 86,242,952 L424R probably damaging Het
Iqgap2 A G 13: 95,750,033 V114A probably damaging Het
Kalrn A T 16: 34,314,209 I401N probably damaging Het
Maats1 A G 16: 38,298,214 V741A probably benign Het
Mast2 T A 4: 116,337,501 probably benign Het
Myo18a A G 11: 77,812,013 E5G possibly damaging Het
Nav3 A T 10: 109,880,533 probably null Het
Net1 G A 13: 3,884,949 T359I probably damaging Het
Pcsk9 T A 4: 106,444,702 H616L probably benign Het
Plekha5 G T 6: 140,589,232 V597L possibly damaging Het
Plekhg3 T A 12: 76,565,247 I374N probably damaging Het
Pros1 A T 16: 62,900,645 R188* probably null Het
Rhbg C T 3: 88,243,448 V434I probably damaging Het
Rims1 A G 1: 22,292,939 probably benign Het
Rxfp2 T C 5: 150,051,633 probably null Het
Sbf2 T C 7: 110,441,466 I385V probably damaging Het
Slc22a23 A C 13: 34,299,004 Y181* probably null Het
Spata31 T A 13: 64,921,655 V539E probably benign Het
Trpv5 G A 6: 41,659,705 R436C probably damaging Het
Vmn1r13 G A 6: 57,209,985 C43Y probably benign Het
Wif1 G A 10: 121,082,194 V156I probably benign Het
Zfyve16 T C 13: 92,504,549 N1229S probably damaging Het
Other mutations in Gabarapl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00844:Gabarapl1 APN 6 129538635 missense probably benign 0.21
R0144:Gabarapl1 UTSW 6 129533448 start codon destroyed probably null 0.97
R1186:Gabarapl1 UTSW 6 129533405 start gained probably benign
R1459:Gabarapl1 UTSW 6 129538672 missense possibly damaging 0.89
R1764:Gabarapl1 UTSW 6 129533518 missense possibly damaging 0.70
R5936:Gabarapl1 UTSW 6 129538603 missense probably benign 0.16
R6336:Gabarapl1 UTSW 6 129537528 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TTTCCCACTAAGGCTCTCGG -3'
(R):5'- AGGGTATCTAATCTCCCAGCGTC -3'

Sequencing Primer
(F):5'- ACTAAGGCTCTCGGACAGCTTTTG -3'
(R):5'- TAATCTCCCAGCGTCACAGTG -3'
Posted On2015-04-30