Incidental Mutation 'R4056:Cyp1a1'
ID314252
Institutional Source Beutler Lab
Gene Symbol Cyp1a1
Ensembl Gene ENSMUSG00000032315
Gene Namecytochrome P450, family 1, subfamily a, polypeptide 1
SynonymsP450-1, cytochrome P450 subfamily I, polypeptide 1
MMRRC Submission 041617-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R4056 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location57687928-57703824 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 57700149 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 20 (V20D)
Ref Sequence ENSEMBL: ENSMUSP00000150277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034865] [ENSMUST00000216433]
Predicted Effect probably benign
Transcript: ENSMUST00000034865
AA Change: V20D

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000034865
Gene: ENSMUSG00000032315
AA Change: V20D

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:p450 44 509 2.3e-111 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216433
AA Change: V20D

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.1212 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, CYP1A1, encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and its expression is induced by some polycyclic aromatic hydrocarbons (PAHs), some of which are found in cigarette smoke. The enzyme's endogenous substrate is unknown; however, it is able to metabolize some PAHs to carcinogenic intermediates. The gene has been associated with lung cancer risk. A related family member, CYP1A2, is located approximately 25 kb away from CYP1A1 on chromosome 15. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a null allele display resitance to some signs of TCDD induced toxicity but do not display any gross abnormalities in the abscence of treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730455P16Rik T A 11: 80,375,503 probably benign Het
Abcf1 A G 17: 35,959,915 I510T possibly damaging Het
Adamts18 T A 8: 113,737,580 K749* probably null Het
Alms1 A G 6: 85,587,803 E53G unknown Het
Bmper A G 9: 23,399,629 H453R probably benign Het
Btg1 T A 10: 96,618,354 M1K probably null Het
Cntfr A G 4: 41,658,900 I277T probably damaging Het
Col6a4 C A 9: 106,026,466 R1642I probably damaging Het
Ctnna3 T C 10: 65,002,568 I808T probably damaging Het
Dnah17 T C 11: 118,070,538 T2554A probably benign Het
Fcgbp A T 7: 28,104,116 Q1715L probably benign Het
Gabarapl1 T C 6: 129,538,630 F77S probably damaging Het
Gm1966 G T 7: 106,604,009 D9E possibly damaging Het
Hpse2 T C 19: 43,294,275 K180E probably damaging Het
Hs3st2 T A 7: 121,500,702 L257Q probably damaging Het
Ighv1-18 T C 12: 114,682,667 T106A probably benign Het
Ints2 A C 11: 86,242,952 L424R probably damaging Het
Iqgap2 A G 13: 95,750,033 V114A probably damaging Het
Kalrn A T 16: 34,314,209 I401N probably damaging Het
Maats1 A G 16: 38,298,214 V741A probably benign Het
Mast2 T A 4: 116,337,501 probably benign Het
Myo18a A G 11: 77,812,013 E5G possibly damaging Het
Nav3 A T 10: 109,880,533 probably null Het
Net1 G A 13: 3,884,949 T359I probably damaging Het
Pcsk9 T A 4: 106,444,702 H616L probably benign Het
Plekha5 G T 6: 140,589,232 V597L possibly damaging Het
Plekhg3 T A 12: 76,565,247 I374N probably damaging Het
Pros1 A T 16: 62,900,645 R188* probably null Het
Rhbg C T 3: 88,243,448 V434I probably damaging Het
Rims1 A G 1: 22,292,939 probably benign Het
Rxfp2 T C 5: 150,051,633 probably null Het
Sbf2 T C 7: 110,441,466 I385V probably damaging Het
Slc22a23 A C 13: 34,299,004 Y181* probably null Het
Spata31 T A 13: 64,921,655 V539E probably benign Het
Trpv5 G A 6: 41,659,705 R436C probably damaging Het
Vmn1r13 G A 6: 57,209,985 C43Y probably benign Het
Wif1 G A 10: 121,082,194 V156I probably benign Het
Zfyve16 T C 13: 92,504,549 N1229S probably damaging Het
Other mutations in Cyp1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Cyp1a1 APN 9 57700707 missense probably damaging 1.00
IGL02427:Cyp1a1 APN 9 57700575 missense probably damaging 1.00
IGL02952:Cyp1a1 APN 9 57702710 missense probably benign
IGL03002:Cyp1a1 APN 9 57702441 splice site probably benign
IGL03085:Cyp1a1 APN 9 57701712 missense possibly damaging 0.89
PIT1430001:Cyp1a1 UTSW 9 57700911 missense probably benign 0.27
R0508:Cyp1a1 UTSW 9 57700305 missense probably benign
R1844:Cyp1a1 UTSW 9 57702697 missense probably benign
R2216:Cyp1a1 UTSW 9 57702069 splice site probably null
R2394:Cyp1a1 UTSW 9 57700149 missense probably benign 0.13
R3966:Cyp1a1 UTSW 9 57700149 missense probably benign 0.13
R4367:Cyp1a1 UTSW 9 57700149 missense probably benign
R4529:Cyp1a1 UTSW 9 57701679 missense probably benign 0.01
R4616:Cyp1a1 UTSW 9 57701756 missense probably benign 0.09
R4656:Cyp1a1 UTSW 9 57702610 missense probably damaging 0.99
R5271:Cyp1a1 UTSW 9 57702838 missense probably benign 0.01
R5324:Cyp1a1 UTSW 9 57702369 missense probably benign 0.13
R6113:Cyp1a1 UTSW 9 57701891 missense probably damaging 1.00
R6189:Cyp1a1 UTSW 9 57700683 missense probably damaging 1.00
R6239:Cyp1a1 UTSW 9 57702078 missense probably benign 0.36
R6382:Cyp1a1 UTSW 9 57700690 missense probably damaging 0.99
R6750:Cyp1a1 UTSW 9 57700256 missense probably benign
R6869:Cyp1a1 UTSW 9 57702784 missense probably benign
R6881:Cyp1a1 UTSW 9 57700719 missense possibly damaging 0.78
R6913:Cyp1a1 UTSW 9 57700293 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACAAGCTCTGTCCTGCTCTATG -3'
(R):5'- TGAAGCTGTAGAGGTCTGGC -3'

Sequencing Primer
(F):5'- TCTATGCCCAGGGAACAGCTC -3'
(R):5'- TCACCAGGGCCTGCTTGATG -3'
Posted On2015-04-30